EMAIL THIS PAGE TO A FRIEND

PRY2

PTPN13-like, Y-linked 2

Synonyms: PTPN13LY2
Species: Human PRY2(442862)
Gene ID:
Human(442862) Summary: This gene is located in the nonrecombining portion of the Y chromosome, and expressed specifically in testis. It encodes a protein which has a low degree of similarity to protein tyrosine phosphatase, non-receptor type 13. Two nearly identical copies of this gene exist within a palindromic region. This record represents the more centromeric copy. [provided by RefSeq, Jul 2008]
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1411899 ANTI-PRY2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002758 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002758 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002758 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002758 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002758 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157191 predicted 283
2 SASI_Hs01_00157192 predicted 447
3 SASI_Hs01_00157193 predicted 581
4 SASI_Hs01_00157194 predicted 1012
5 SASI_Hs01_00157195 predicted 377
6 SASI_Hs01_00157196 predicted 692
7 SASI_Hs01_00157197 predicted 376
8 SASI_Hs01_00157198 predicted 795
9 SASI_Hs01_00157199 predicted 656
10 SASI_Hs01_00157200 predicted 418
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002758
PRY2 MISSION shRNA Bacterial Glycerol Stock
PTPN13-like, Y-linked 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002758.1-556s1c1
Sequence:CCGGGAAGCAGGTTATCTTCACAGTCTCGAGACTGTGAAGATAACCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002758.1-650s1c1
Sequence:CCGGCCACGTTCATGAAGAAGACTACTCGAGTAGTCTTCTTCATGAACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002758.1-560s1c1
Sequence:CCGGCAGGTTATCTTCACAGTGCCTCTCGAGAGGCACTGTGAAGATAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002758.1-372s1c1
Sequence:CCGGGCCAGAAGGAAGAAGGATCTTCTCGAGAAGATCCTTCTTCCTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002758.1-396s1c1
Sequence:CCGGGACTCATTTCTCTGGAGATATCTCGAGATATCTCCAGAGAAATGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002758.1-267s1c1
Sequence:CCGGCAAGACAATTTGAATGGCACTCTCGAGAGTGCCATTCAAATTGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002758
PRY2 MISSION shRNA shRNA Plasmid DNA
PTPN13-like, Y-linked 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002758.1-556s1c1
Sequence:CCGGGAAGCAGGTTATCTTCACAGTCTCGAGACTGTGAAGATAACCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002758.1-650s1c1
Sequence:CCGGCCACGTTCATGAAGAAGACTACTCGAGTAGTCTTCTTCATGAACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002758.1-560s1c1
Sequence:CCGGCAGGTTATCTTCACAGTGCCTCTCGAGAGGCACTGTGAAGATAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002758.1-372s1c1
Sequence:CCGGGCCAGAAGGAAGAAGGATCTTCTCGAGAAGATCCTTCTTCCTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002758.1-396s1c1
Sequence:CCGGGACTCATTTCTCTGGAGATATCTCGAGATATCTCCAGAGAAATGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002758.1-267s1c1
Sequence:CCGGCAAGACAATTTGAATGGCACTCTCGAGAGTGCCATTCAAATTGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002758
PRY2 MISSION shRNA Lentiviral Transduction Particles
PTPN13-like, Y-linked 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002758.1-556s1c1
Sequence:CCGGGAAGCAGGTTATCTTCACAGTCTCGAGACTGTGAAGATAACCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002758.1-650s1c1
Sequence:CCGGCCACGTTCATGAAGAAGACTACTCGAGTAGTCTTCTTCATGAACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002758.1-560s1c1
Sequence:CCGGCAGGTTATCTTCACAGTGCCTCTCGAGAGGCACTGTGAAGATAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002758.1-372s1c1
Sequence:CCGGGCCAGAAGGAAGAAGGATCTTCTCGAGAAGATCCTTCTTCCTTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002758.1-396s1c1
Sequence:CCGGGACTCATTTCTCTGGAGATATCTCGAGATATCTCCAGAGAAATGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002758.1-267s1c1
Sequence:CCGGCAAGACAATTTGAATGGCACTCTCGAGAGTGCCATTCAAATTGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks