EMAIL THIS PAGE TO A FRIEND

PSD3

pleckstrin and Sec7 domain containing 3

Synonyms: EFA6R HCA67
UniProtKB ID: Q9NYI0, A6NFQ4, E9KL50, Q6B003, Q9Y2F1
Gene ID:
Mouse(234353) pleckstrin and Sec7 domain containing 3
Rat(306380) pleckstrin and Sec7 domain containing 3
cow(531459) pleckstrin and Sec7 domain containing 3
sheep(101102782) pleckstrin and Sec7 domain containing 3
naked mole-rat(101698221) pleckstrin and Sec7 domain containing 3
Domestic Rabbit(100340681) pleckstrin and Sec7 domain containing 3
domestic guinea pig(100724621) pleckstrin and Sec7 domain containing 3
Thale Cress(828703) phosphatidylserine decarboxylase 3
domestic cat(101095821) pleckstrin and Sec7 domain containing 3
Horse(100051830) pleckstrin and Sec7 domain containing 3
dog(606759) pleckstrin and Sec7 domain containing 3
chicken(770334) pleckstrin and Sec7 domain containing 3
373 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015310 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015310 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015310 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177698 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177698 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177698 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU073501 MISSION® esiRNA esiRNA human PSD3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015310 Rosetta Predictions human pricing
NM_206909 Rosetta Predictions human pricing
XM_001070777 Rosetta Predictions rat pricing
XM_224759 Rosetta Predictions rat pricing
NM_027626 Rosetta Predictions mouse pricing
NM_030263 Rosetta Predictions mouse pricing
NM_177698 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015310 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347544 predicted 3071
2 SASI_Hs02_00347545 predicted 2609
3 SASI_Hs02_00347546 predicted 2819
4 SASI_Hs02_00347547 predicted 2774
5 SASI_Hs02_00347548 predicted 2742
6 SASI_Hs02_00347549 predicted 2894
7 SASI_Hs02_00347550 predicted 2675
8 SASI_Hs02_00347551 predicted 2893
9 SASI_Hs02_00347552 predicted 1955
10 SASI_Hs02_00347553 predicted 2559
11 SASI_Hs01_00109662 predicted 2277
12 SASI_Hs01_00109663 predicted 1932
13 SASI_Hs01_00109664 predicted 744
14 SASI_Hs01_00109665 predicted 1559
15 SASI_Hs01_00109666 predicted 528
16 SASI_Hs01_00109667 predicted 796
17 SASI_Hs01_00109668 predicted 126
18 SASI_Hs01_00109669 predicted 1546
19 SASI_Hs01_00109670 predicted 2144
20 SASI_Hs01_00109671 predicted 2190
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206909 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373596 predicted 1473
2 SASI_Hs01_00177420 predicted 1005
3 SASI_Hs02_00373597 predicted 1219
4 SASI_Hs01_00177422 predicted 1178
5 SASI_Hs01_00177424 predicted 1147
6 SASI_Hs01_00177426 predicted 1305
7 SASI_Hs02_00373598 predicted 1078
8 SASI_Hs02_00373599 predicted 1297
9 SASI_Hs02_00373600 predicted 358
10 SASI_Hs02_00373601 predicted 958
11 SASI_Hs01_00177419 predicted 1364
12 SASI_Hs01_00177421 predicted 1458
13 SASI_Hs01_00177423 predicted 1210
14 SASI_Hs01_00177425 predicted 1138
15 SASI_Hs01_00177427 predicted 1370
16 SASI_Hs01_00177428 predicted 1462
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070777 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00332755 predicted 756
2 SASI_Rn02_00332756 predicted 2634
3 SASI_Rn02_00332757 predicted 2125
4 SASI_Rn02_00332758 predicted 1721
5 SASI_Rn02_00332759 predicted 874
6 SASI_Rn02_00332760 predicted 1472
7 SASI_Rn02_00332761 predicted 2445
8 SASI_Rn02_00332762 predicted 2033
9 SASI_Rn02_00332763 predicted 2567
10 SASI_Rn02_00332764 predicted 2606
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224759 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382239 predicted 757
2 SASI_Rn02_00382240 predicted 2643
3 SASI_Rn02_00382241 predicted 2127
4 SASI_Rn02_00382242 predicted 1725
5 SASI_Rn02_00382243 predicted 871
6 SASI_Rn02_00382244 predicted 1474
7 SASI_Rn02_00382245 predicted 2447
8 SASI_Rn02_00382246 predicted 2035
9 SASI_Rn02_00382247 predicted 2564
10 SASI_Rn02_00382248 predicted 2601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027626 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332479 predicted 1236
2 SASI_Mm02_00332480 predicted 1376
3 SASI_Mm02_00332481 predicted 1151
4 SASI_Mm02_00332482 predicted 635
5 SASI_Mm02_00332483 predicted 777
6 SASI_Mm02_00332484 predicted 678
7 SASI_Mm02_00332485 predicted 752
8 SASI_Mm02_00332486 predicted 721
9 SASI_Mm02_00332487 predicted 969
10 SASI_Mm02_00332488 predicted 1281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030263 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336745 predicted 1578
2 SASI_Mm02_00336746 predicted 1724
3 SASI_Mm01_00172779 predicted 1491
4 SASI_Mm01_00172780 predicted 974
5 SASI_Mm01_00172781 predicted 1126
6 SASI_Mm01_00172782 predicted 1022
7 SASI_Mm01_00172783 predicted 1100
8 SASI_Mm01_00172784 predicted 1071
9 SASI_Mm01_00172785 predicted 1317
10 SASI_Mm02_00336747 predicted 1625
11 SASI_Mm01_00172786 predicted 968
12 SASI_Mm01_00172787 predicted 978
13 SASI_Mm01_00172788 predicted 992
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177698 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348043 predicted 3345
2 SASI_Mm02_00348044 predicted 3486
3 SASI_Mm01_00126207 predicted 3256
4 SASI_Mm01_00126208 predicted 2738
5 SASI_Mm01_00126209 predicted 2884
6 SASI_Mm01_00126210 predicted 2787
7 SASI_Mm01_00126211 predicted 2864
8 SASI_Mm01_00126212 predicted 2836
9 SASI_Mm01_00126213 predicted 3077
10 SASI_Mm02_00348045 predicted 3391
11 SASI_Mm01_00126214 predicted 2746
12 SASI_Mm01_00126215 predicted 2758
13 SASI_Mm01_00126216 predicted 2771
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015310
PSD3 MISSION shRNA Bacterial Glycerol Stock
pleckstrin and Sec7 domain containing 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015310.2-2145s1c1
Sequence:CCGGCCTGTGCAATAATGCTTCTTACTCGAGTAAGAAGCATTATTGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123164    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015310.2-3675s1c1
Sequence:CCGGCGCCTTTATATGTGAAATCTTCTCGAGAAGATTTCACATATAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015310.2-1428s1c1
Sequence:CCGGGCTCCCAGTTTGAAACCATTTCTCGAGAAATGGTTTCAAACTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015310.2-543s1c1
Sequence:CCGGCCGGAACATTACAGGCTACAACTCGAGTTGTAGCCTGTAATGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015310.2-2146s1c1
Sequence:CCGGCTGTGCAATAATGCTTCTTAACTCGAGTTAAGAAGCATTATTGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015310.3-2399s21c1
Sequence:CCGGCGTATTGGAAGTACTACTAACCTCGAGGTTAGTAGTACTTCCAATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015310.3-1544s21c1
Sequence:CCGGATGATACAACAGCGCATTAAACTCGAGTTTAATGCGCTGTTGTATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015310
PSD3 MISSION shRNA shRNA Plasmid DNA
pleckstrin and Sec7 domain containing 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015310.2-2145s1c1
Sequence:CCGGCCTGTGCAATAATGCTTCTTACTCGAGTAAGAAGCATTATTGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123164    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015310.2-3675s1c1
Sequence:CCGGCGCCTTTATATGTGAAATCTTCTCGAGAAGATTTCACATATAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015310.2-1428s1c1
Sequence:CCGGGCTCCCAGTTTGAAACCATTTCTCGAGAAATGGTTTCAAACTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015310.2-543s1c1
Sequence:CCGGCCGGAACATTACAGGCTACAACTCGAGTTGTAGCCTGTAATGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015310.2-2146s1c1
Sequence:CCGGCTGTGCAATAATGCTTCTTAACTCGAGTTAAGAAGCATTATTGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015310.3-2399s21c1
Sequence:CCGGCGTATTGGAAGTACTACTAACCTCGAGGTTAGTAGTACTTCCAATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015310.3-1544s21c1
Sequence:CCGGATGATACAACAGCGCATTAAACTCGAGTTTAATGCGCTGTTGTATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015310
PSD3 MISSION shRNA Lentiviral Transduction Particles
pleckstrin and Sec7 domain containing 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015310.2-2145s1c1
Sequence:CCGGCCTGTGCAATAATGCTTCTTACTCGAGTAAGAAGCATTATTGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123164    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015310.2-3675s1c1
Sequence:CCGGCGCCTTTATATGTGAAATCTTCTCGAGAAGATTTCACATATAAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015310.2-1428s1c1
Sequence:CCGGGCTCCCAGTTTGAAACCATTTCTCGAGAAATGGTTTCAAACTGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015310.2-543s1c1
Sequence:CCGGCCGGAACATTACAGGCTACAACTCGAGTTGTAGCCTGTAATGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015310.2-2146s1c1
Sequence:CCGGCTGTGCAATAATGCTTCTTAACTCGAGTTAAGAAGCATTATTGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015310.3-2399s21c1
Sequence:CCGGCGTATTGGAAGTACTACTAACCTCGAGGTTAGTAGTACTTCCAATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015310.3-1544s21c1
Sequence:CCGGATGATACAACAGCGCATTAAACTCGAGTTTAATGCGCTGTTGTATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177698
VALIDATED
PSD3 MISSION shRNA Bacterial Glycerol Stock
pleckstrin and Sec7 domain containing 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110075    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177698.2-1507s1c1
Sequence:CCGGCCCGATTATATGGCATTTCTTCTCGAGAAGAAATGCCATATAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177698.2-702s1c1
Sequence:CCGGGCCGAACGTGTTTAAACTCAACTCGAGTTGAGTTTAAACACGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177698.2-400s1c1
Sequence:CCGGCCAAAGACTATCAGTCGTATTCTCGAGAATACGACTGATAGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177698.2-1201s1c1
Sequence:CCGGCTTGGCTCATTCATCTTGAATCTCGAGATTCAAGATGAATGAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177698.2-374s1c1
Sequence:CCGGCTGATGAGAAGGCTAATGGAACTCGAGTTCCATTAGCCTTCTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177698.4-1662s21c1
Sequence:CCGGTTCGGAACCGGATAGCTATTTCTCGAGAAATAGCTATCCGGTTCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177698.4-976s21c1
Sequence:CCGGCATCGGTCCCAGATAACTAATCTCGAGATTAGTTATCTGGGACCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177698.4-3484s21c1
Sequence:CCGGTTTCTGGTAATCCGTGAATATCTCGAGATATTCACGGATTACCAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177698.4-2537s21c1
Sequence:CCGGCTGATGAGAAGGCTAATGGAACTCGAGTTCCATTAGCCTTCTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177698.4-2865s21c1
Sequence:CCGGGCCGAACGTGTTTAAACTCAACTCGAGTTGAGTTTAAACACGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177698
VALIDATED
PSD3 MISSION shRNA shRNA Plasmid DNA
pleckstrin and Sec7 domain containing 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110075    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177698.2-1507s1c1
Sequence:CCGGCCCGATTATATGGCATTTCTTCTCGAGAAGAAATGCCATATAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177698.2-702s1c1
Sequence:CCGGGCCGAACGTGTTTAAACTCAACTCGAGTTGAGTTTAAACACGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177698.2-400s1c1
Sequence:CCGGCCAAAGACTATCAGTCGTATTCTCGAGAATACGACTGATAGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177698.2-1201s1c1
Sequence:CCGGCTTGGCTCATTCATCTTGAATCTCGAGATTCAAGATGAATGAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177698.2-374s1c1
Sequence:CCGGCTGATGAGAAGGCTAATGGAACTCGAGTTCCATTAGCCTTCTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177698.4-1662s21c1
Sequence:CCGGTTCGGAACCGGATAGCTATTTCTCGAGAAATAGCTATCCGGTTCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177698.4-976s21c1
Sequence:CCGGCATCGGTCCCAGATAACTAATCTCGAGATTAGTTATCTGGGACCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177698.4-3484s21c1
Sequence:CCGGTTTCTGGTAATCCGTGAATATCTCGAGATATTCACGGATTACCAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177698.4-2537s21c1
Sequence:CCGGCTGATGAGAAGGCTAATGGAACTCGAGTTCCATTAGCCTTCTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177698.4-2865s21c1
Sequence:CCGGGCCGAACGTGTTTAAACTCAACTCGAGTTGAGTTTAAACACGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177698
VALIDATED
PSD3 MISSION shRNA Lentiviral Transduction Particles
pleckstrin and Sec7 domain containing 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110075    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177698.2-1507s1c1
Sequence:CCGGCCCGATTATATGGCATTTCTTCTCGAGAAGAAATGCCATATAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177698.2-702s1c1
Sequence:CCGGGCCGAACGTGTTTAAACTCAACTCGAGTTGAGTTTAAACACGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177698.2-400s1c1
Sequence:CCGGCCAAAGACTATCAGTCGTATTCTCGAGAATACGACTGATAGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177698.2-1201s1c1
Sequence:CCGGCTTGGCTCATTCATCTTGAATCTCGAGATTCAAGATGAATGAGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177698.2-374s1c1
Sequence:CCGGCTGATGAGAAGGCTAATGGAACTCGAGTTCCATTAGCCTTCTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177698.4-1662s21c1
Sequence:CCGGTTCGGAACCGGATAGCTATTTCTCGAGAAATAGCTATCCGGTTCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177698.4-976s21c1
Sequence:CCGGCATCGGTCCCAGATAACTAATCTCGAGATTAGTTATCTGGGACCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177698.4-3484s21c1
Sequence:CCGGTTTCTGGTAATCCGTGAATATCTCGAGATATTCACGGATTACCAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177698.4-2537s21c1
Sequence:CCGGCTGATGAGAAGGCTAATGGAACTCGAGTTCCATTAGCCTTCTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177698.4-2865s21c1
Sequence:CCGGGCCGAACGTGTTTAAACTCAACTCGAGTTGAGTTTAAACACGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks