EMAIL THIS PAGE TO A FRIEND

PSG5

pregnancy specific beta-1-glycoprotein 5

Synonyms: FL-NCA-3 PSG
Species: Human PSG5(5673)
UniProtKB ID: Q15238, Q15239, Q96QJ1, Q9UQ75
Gene ID:
Human(5673) Summary: The human pregnancy-specific glycoproteins (PSGs) are a group of molecules that are mainly produced by the placental syncytiotrophoblasts during pregnancy. PSGs comprise a subgroup of the carcinoembryonic antigen (CEA) family, which belongs to the immunoglobulin superfamily. For additional general information about the PSG gene family, see PSG1 (MIM 176390).[supplied by OMIM, Oct 2009]
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV42067 Anti-PSG5 antibody produced in rabbit IgG fraction of antiserum mouse, horse, canine, human, rat
western blot pricing
SAB2104759 Anti-PSG5 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002781 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002781 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002781 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002781 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002781 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103529 predicted 505
2 SASI_Hs01_00103533 predicted 302
3 SASI_Hs01_00103527 predicted 727
4 SASI_Hs01_00103528 predicted 371
5 SASI_Hs01_00103530 predicted 933
6 SASI_Hs01_00103531 predicted 377
7 SASI_Hs01_00103532 predicted 920
8 SASI_Hs01_00103534 predicted 920
9 SASI_Hs01_00103535 predicted 987
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002781
VALIDATED
PSG5 MISSION shRNA Bacterial Glycerol Stock
pregnancy specific beta-1-glycoprotein 5
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002781.2-976s1c1
Sequence:CCGGCAAAGCATAGAGGGCTCTATACTCGAGTATAGAGCCCTCTATGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002781.2-602s1c1
Sequence:CCGGCTGTGAACCTAAGAGTGAGAACTCGAGTTCTCACTCTTAGGTTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002781.2-1083s1c1
Sequence:CCGGCTTCCTCTCCTTAATCCAATACTCGAGTATTGGATTAAGGAGAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002781.2-314s1c1
Sequence:CCGGGATGGACCTCTACCATTACATCTCGAGATGTAATGGTAGAGGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154402    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002781.2-1109s1c1
Sequence:CCGGGCCGTGAAGTCATTTCTGTATCTCGAGATACAGAAATGACTTCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002781.2-1150s1c1
Sequence:CCGGGTTGCTTTGATTCTTCCTCAACTCGAGTTGAGGAAGAATCAAAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002781.2-1065s1c1
Sequence:CCGGCCTTCAGGAATAGGACGTCTTCTCGAGAAGACGTCCTATTCCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002781.2-789s1c1
Sequence:CCGGGTCACCCTGAATGTCCTCTATCTCGAGATAGAGGACATTCAGGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002781.3-741s21c1
Sequence:CCGGCTACCCAGTGTCACGAGAAATCTCGAGATTTCTCGTGACACTGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002781.3-660s21c1
Sequence:CCGGACCTACATTTGGTGGCTAAATCTCGAGATTTAGCCACCAAATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002781.3-1392s21c1
Sequence:CCGGTCCATGTTATTGGACTAAATACTCGAGTATTTAGTCCAATAACATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002781.3-863s21c1
Sequence:CCGGTTACCCTTCATTCACCTATTACTCGAGTAATAGGTGAATGAAGGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002781.3-488s21c1
Sequence:CCGGCTACACCTTACACATCATAAACTCGAGTTTATGATGTGTAAGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002781
VALIDATED
PSG5 MISSION shRNA shRNA Plasmid DNA
pregnancy specific beta-1-glycoprotein 5
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002781.2-976s1c1
Sequence:CCGGCAAAGCATAGAGGGCTCTATACTCGAGTATAGAGCCCTCTATGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002781.2-602s1c1
Sequence:CCGGCTGTGAACCTAAGAGTGAGAACTCGAGTTCTCACTCTTAGGTTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002781.2-1083s1c1
Sequence:CCGGCTTCCTCTCCTTAATCCAATACTCGAGTATTGGATTAAGGAGAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002781.2-314s1c1
Sequence:CCGGGATGGACCTCTACCATTACATCTCGAGATGTAATGGTAGAGGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154402    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002781.2-1109s1c1
Sequence:CCGGGCCGTGAAGTCATTTCTGTATCTCGAGATACAGAAATGACTTCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002781.2-1150s1c1
Sequence:CCGGGTTGCTTTGATTCTTCCTCAACTCGAGTTGAGGAAGAATCAAAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002781.2-1065s1c1
Sequence:CCGGCCTTCAGGAATAGGACGTCTTCTCGAGAAGACGTCCTATTCCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002781.2-789s1c1
Sequence:CCGGGTCACCCTGAATGTCCTCTATCTCGAGATAGAGGACATTCAGGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002781.3-741s21c1
Sequence:CCGGCTACCCAGTGTCACGAGAAATCTCGAGATTTCTCGTGACACTGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002781.3-660s21c1
Sequence:CCGGACCTACATTTGGTGGCTAAATCTCGAGATTTAGCCACCAAATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002781.3-1392s21c1
Sequence:CCGGTCCATGTTATTGGACTAAATACTCGAGTATTTAGTCCAATAACATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002781.3-863s21c1
Sequence:CCGGTTACCCTTCATTCACCTATTACTCGAGTAATAGGTGAATGAAGGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002781.3-488s21c1
Sequence:CCGGCTACACCTTACACATCATAAACTCGAGTTTATGATGTGTAAGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002781
VALIDATED
PSG5 MISSION shRNA Lentiviral Transduction Particles
pregnancy specific beta-1-glycoprotein 5
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002781.2-976s1c1
Sequence:CCGGCAAAGCATAGAGGGCTCTATACTCGAGTATAGAGCCCTCTATGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002781.2-602s1c1
Sequence:CCGGCTGTGAACCTAAGAGTGAGAACTCGAGTTCTCACTCTTAGGTTCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002781.2-1083s1c1
Sequence:CCGGCTTCCTCTCCTTAATCCAATACTCGAGTATTGGATTAAGGAGAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002781.2-314s1c1
Sequence:CCGGGATGGACCTCTACCATTACATCTCGAGATGTAATGGTAGAGGTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154402    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002781.2-1109s1c1
Sequence:CCGGGCCGTGAAGTCATTTCTGTATCTCGAGATACAGAAATGACTTCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002781.2-1150s1c1
Sequence:CCGGGTTGCTTTGATTCTTCCTCAACTCGAGTTGAGGAAGAATCAAAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002781.2-1065s1c1
Sequence:CCGGCCTTCAGGAATAGGACGTCTTCTCGAGAAGACGTCCTATTCCTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002781.2-789s1c1
Sequence:CCGGGTCACCCTGAATGTCCTCTATCTCGAGATAGAGGACATTCAGGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002781.3-741s21c1
Sequence:CCGGCTACCCAGTGTCACGAGAAATCTCGAGATTTCTCGTGACACTGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002781.3-660s21c1
Sequence:CCGGACCTACATTTGGTGGCTAAATCTCGAGATTTAGCCACCAAATGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002781.3-1392s21c1
Sequence:CCGGTCCATGTTATTGGACTAAATACTCGAGTATTTAGTCCAATAACATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002781.3-863s21c1
Sequence:CCGGTTACCCTTCATTCACCTATTACTCGAGTAATAGGTGAATGAAGGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002781.3-488s21c1
Sequence:CCGGCTACACCTTACACATCATAAACTCGAGTTTATGATGTGTAAGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks