EMAIL THIS PAGE TO A FRIEND

PSG9

pregnancy specific beta-1-glycoprotein 9

Synonyms: PS34 PSBG-11 PSBG-9 PSG11 PSGII
Species: Human PSG9(5678)
UniProtKB ID: Q00887, B2R869, Q15236, Q15237, Q8WW78, Q9UQ73
Gene ID:
Human(5678) Summary: The human pregnancy-specific glycoproteins (PSGs) are a group of molecules that are mainly produced by the placental syncytiotrophoblasts during pregnancy. PSGs comprise a subgroup of the carcinoembryonic antigen (CEA) family, which belongs to the immunoglobulin superfamily. For additional general information about the PSG gene family, see PSG1 (MIM 176390).[supplied by OMIM, Oct 2009]
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002784 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002784 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002784 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153201 MISSION® esiRNA esiRNA human PSG9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002784 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002784 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237066 predicted 340
2 SASI_Hs01_00237068 predicted 486
3 SASI_Hs01_00237070 predicted 332
4 SASI_Hs01_00237069 predicted 482
5 SASI_Hs02_00334420 predicted 1378
6 SASI_Hs01_00237067 predicted 372
7 SASI_Hs01_00237071 predicted 1054
8 SASI_Hs01_00237072 predicted 464
9 SASI_Hs01_00237073 predicted 496
10 SASI_Hs01_00237074 predicted 1271
11 SASI_Hs01_00237075 predicted 1203
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002784
VALIDATED
PSG9 MISSION shRNA Bacterial Glycerol Stock
pregnancy specific beta-1-glycoprotein 9
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183406    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002784.2-1562s1c1
Sequence:CCGGCTTCAGCAATTGGTAAAGTATCTCGAGATACTTTACCAATTGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002784.2-284s1c1
Sequence:CCGGCCTGGCTACTTCTGGTACAAACTCGAGTTTGTACCAGAAGTAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002784.2-1067s1c1
Sequence:CCGGGTCATCCTAAATGTCCTCTATCTCGAGATAGAGGACATTTAGGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002784.3-478s21c1
Sequence:CCGGCGAGGTGATGAGACTAGAGAACTCGAGTTCTCTAGTCTCATCACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002784.3-492s21c1
Sequence:CCGGTAGAGAAGAAATTCGACATTTCTCGAGAAATGTCGAATTTCTTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002784.3-1384s21c1
Sequence:CCGGCAACAACTGAGACACTGAGAACTCGAGTTCTCAGTGTCTCAGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002784.3-1371s21c1
Sequence:CCGGTCAGTCATGACTGCAACAACTCTCGAGAGTTGTTGCAGTCATGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002784
VALIDATED
PSG9 MISSION shRNA shRNA Plasmid DNA
pregnancy specific beta-1-glycoprotein 9
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183406    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002784.2-1562s1c1
Sequence:CCGGCTTCAGCAATTGGTAAAGTATCTCGAGATACTTTACCAATTGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002784.2-284s1c1
Sequence:CCGGCCTGGCTACTTCTGGTACAAACTCGAGTTTGTACCAGAAGTAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002784.2-1067s1c1
Sequence:CCGGGTCATCCTAAATGTCCTCTATCTCGAGATAGAGGACATTTAGGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002784.3-478s21c1
Sequence:CCGGCGAGGTGATGAGACTAGAGAACTCGAGTTCTCTAGTCTCATCACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002784.3-492s21c1
Sequence:CCGGTAGAGAAGAAATTCGACATTTCTCGAGAAATGTCGAATTTCTTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002784.3-1384s21c1
Sequence:CCGGCAACAACTGAGACACTGAGAACTCGAGTTCTCAGTGTCTCAGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002784.3-1371s21c1
Sequence:CCGGTCAGTCATGACTGCAACAACTCTCGAGAGTTGTTGCAGTCATGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002784
VALIDATED
PSG9 MISSION shRNA Lentiviral Transduction Particles
pregnancy specific beta-1-glycoprotein 9
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183406    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002784.2-1562s1c1
Sequence:CCGGCTTCAGCAATTGGTAAAGTATCTCGAGATACTTTACCAATTGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002784.2-284s1c1
Sequence:CCGGCCTGGCTACTTCTGGTACAAACTCGAGTTTGTACCAGAAGTAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002784.2-1067s1c1
Sequence:CCGGGTCATCCTAAATGTCCTCTATCTCGAGATAGAGGACATTTAGGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002784.3-478s21c1
Sequence:CCGGCGAGGTGATGAGACTAGAGAACTCGAGTTCTCTAGTCTCATCACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002784.3-492s21c1
Sequence:CCGGTAGAGAAGAAATTCGACATTTCTCGAGAAATGTCGAATTTCTTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002784.3-1384s21c1
Sequence:CCGGCAACAACTGAGACACTGAGAACTCGAGTTCTCAGTGTCTCAGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002784.3-1371s21c1
Sequence:CCGGTCAGTCATGACTGCAACAACTCTCGAGAGTTGTTGCAGTCATGACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks