EMAIL THIS PAGE TO A FRIEND

PSKH1

protein serine kinase H1

UniProtKB ID: P11801, Q9NY19
Gene ID:
Mouse(244631) protein serine kinase H1
Rat(364993) protein serine kinase H1
Zebrafish(554840) protein serine kinase H1
dog(100687571) protein serine kinase H1
Horse(100053657) protein serine kinase H1
domestic cat(101081942) protein serine kinase H1
chicken(415658) protein serine kinase H1
cow(509656) protein serine kinase H1
sheep(101116671) protein serine kinase H1
naked mole-rat(101702042) protein serine kinase H1
domestic guinea pig(100728252) protein serine kinase H1
170 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502432 Anti-KPSH1 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing
SAB1302049 ANTI-MOUSE PSKH1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB1300824 Anti-PSKH1 (C-term) antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB1300823 Anti-PSKH1 (N-term C3) antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1300825 Anti-PSKH1 (N-term H70) antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1300826 Anti-PSKH1 (N-term L9) antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1300401 Anti-PSKH1 (N-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
ELISA, immunohistochemistry, western blot pricing
HPA053927 Anti-PSKH1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2107210 Anti-PSKH1 antibody produced in rabbit affinity isolated antibody human, guinea pig, horse, mouse, rabbit
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006742 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006742 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006742 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173432 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173432 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173432 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006742 Rosetta Predictions human pricing
NM_001108897 Rosetta Predictions rat pricing
NM_173432 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006742 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215107 predicted 1857
2 SASI_Hs01_00215108 predicted 431
3 SASI_Hs01_00215109 predicted 1375
4 SASI_Hs01_00215111 predicted 251
5 SASI_Hs01_00215112 predicted 203
6 SASI_Hs01_00215113 predicted 1492
7 SASI_Hs01_00215114 predicted 821
8 SASI_Hs01_00215115 predicted 386
9 SASI_Hs02_00342192 predicted 1898
10 SASI_Hs02_00342193 predicted 413
11 SASI_Hs01_00215110 predicted 500
12 SASI_Hs01_00215116 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108897 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243165 predicted 233
2 SASI_Rn02_00243166 predicted 618
3 SASI_Rn02_00243167 predicted 717
4 SASI_Rn02_00243168 predicted 294
5 SASI_Rn02_00243169 predicted 786
6 SASI_Rn02_00243170 predicted 380
7 SASI_Rn02_00243171 predicted 229
8 SASI_Rn02_00243172 predicted 455
9 SASI_Rn02_00243173 predicted 811
10 SASI_Rn02_00243174 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173432 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062085 predicted 1508
2 SASI_Mm01_00062087 predicted 683
3 SASI_Mm01_00062088 predicted 224
4 SASI_Mm01_00062089 predicted 1383
5 SASI_Mm01_00062090 predicted 1419
6 SASI_Mm02_00345317 predicted 442
7 SASI_Mm01_00062091 predicted 1178
8 SASI_Mm01_00062092 predicted 383
9 SASI_Mm01_00062093 predicted 1445
10 SASI_Mm01_00062094 predicted 718
11 SASI_Mm01_00062086 predicted 263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006742
VALIDATED
PSKH1 MISSION shRNA Bacterial Glycerol Stock
protein serine kinase H1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006742.1-216s1c1
Sequence:CCGGGCACTAAGAGTGACGTGTACACTCGAGTGTACACGTCACTCTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199111    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006742.1-2142s1c1
Sequence:CCGGCCGCCCTTGGTGCCTTCTTTGCTCGAGCAAAGAAGGCACCAAGGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199307    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006742.1-2186s1c1
Sequence:CCGGCCCGTTGATGTCCATTCCATTCTCGAGAATGGAATGGACATCAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006742.x-2715s1c1
Sequence:CCGGTCCCTTCACAGCATTAACCTTCTCGAGAAGGTTAATGCTGTGAAGGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006742.x-1231s1c1
Sequence:CCGGGCACCGCTCCATATCCCAGAACTCGAGTTCTGGGATATGGAGCGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006742.x-380s1c1
Sequence:CCGGGCTAAGTACAGGGCCAAGTTTCTCGAGAAACTTGGCCCTGTACTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006742.x-943s1c1
Sequence:CCGGCAAGCCATACACCAACTCAGTCTCGAGACTGAGTTGGTGTATGGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006742.x-1315s1c1
Sequence:CCGGCCGCTCCACACGCTCCAATAACTCGAGTTATTGGAGCGTGTGGAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_006742.2-420s21c1
Sequence:CCGGGCTAAGTACAGGGCCAAGTTTCTCGAGAAACTTGGCCCTGTACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006742.2-1355s21c1
Sequence:CCGGCCGCTCCACACGCTCCAATAACTCGAGTTATTGGAGCGTGTGGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006742.2-1271s21c1
Sequence:CCGGGCACCGCTCCATATCCCAGAACTCGAGTTCTGGGATATGGAGCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_006742.2-2759s21c1
Sequence:CCGGTCCCTTCACAGCATTAACCTTCTCGAGAAGGTTAATGCTGTGAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_006742.2-983s21c1
Sequence:CCGGCAAGCCATACACCAACTCAGTCTCGAGACTGAGTTGGTGTATGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006742
VALIDATED
PSKH1 MISSION shRNA shRNA Plasmid DNA
protein serine kinase H1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006742.1-216s1c1
Sequence:CCGGGCACTAAGAGTGACGTGTACACTCGAGTGTACACGTCACTCTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199111    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006742.1-2142s1c1
Sequence:CCGGCCGCCCTTGGTGCCTTCTTTGCTCGAGCAAAGAAGGCACCAAGGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199307    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006742.1-2186s1c1
Sequence:CCGGCCCGTTGATGTCCATTCCATTCTCGAGAATGGAATGGACATCAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006742.x-2715s1c1
Sequence:CCGGTCCCTTCACAGCATTAACCTTCTCGAGAAGGTTAATGCTGTGAAGGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006742.x-1231s1c1
Sequence:CCGGGCACCGCTCCATATCCCAGAACTCGAGTTCTGGGATATGGAGCGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006742.x-380s1c1
Sequence:CCGGGCTAAGTACAGGGCCAAGTTTCTCGAGAAACTTGGCCCTGTACTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006742.x-943s1c1
Sequence:CCGGCAAGCCATACACCAACTCAGTCTCGAGACTGAGTTGGTGTATGGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006742.x-1315s1c1
Sequence:CCGGCCGCTCCACACGCTCCAATAACTCGAGTTATTGGAGCGTGTGGAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_006742.2-420s21c1
Sequence:CCGGGCTAAGTACAGGGCCAAGTTTCTCGAGAAACTTGGCCCTGTACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006742.2-1355s21c1
Sequence:CCGGCCGCTCCACACGCTCCAATAACTCGAGTTATTGGAGCGTGTGGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006742.2-1271s21c1
Sequence:CCGGGCACCGCTCCATATCCCAGAACTCGAGTTCTGGGATATGGAGCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_006742.2-2759s21c1
Sequence:CCGGTCCCTTCACAGCATTAACCTTCTCGAGAAGGTTAATGCTGTGAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_006742.2-983s21c1
Sequence:CCGGCAAGCCATACACCAACTCAGTCTCGAGACTGAGTTGGTGTATGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006742
VALIDATED
PSKH1 MISSION shRNA Lentiviral Transduction Particles
protein serine kinase H1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006742.1-216s1c1
Sequence:CCGGGCACTAAGAGTGACGTGTACACTCGAGTGTACACGTCACTCTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199111    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006742.1-2142s1c1
Sequence:CCGGCCGCCCTTGGTGCCTTCTTTGCTCGAGCAAAGAAGGCACCAAGGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199307    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006742.1-2186s1c1
Sequence:CCGGCCCGTTGATGTCCATTCCATTCTCGAGAATGGAATGGACATCAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006742.x-2715s1c1
Sequence:CCGGTCCCTTCACAGCATTAACCTTCTCGAGAAGGTTAATGCTGTGAAGGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006742.x-1231s1c1
Sequence:CCGGGCACCGCTCCATATCCCAGAACTCGAGTTCTGGGATATGGAGCGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006742.x-380s1c1
Sequence:CCGGGCTAAGTACAGGGCCAAGTTTCTCGAGAAACTTGGCCCTGTACTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006742.x-943s1c1
Sequence:CCGGCAAGCCATACACCAACTCAGTCTCGAGACTGAGTTGGTGTATGGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006742.x-1315s1c1
Sequence:CCGGCCGCTCCACACGCTCCAATAACTCGAGTTATTGGAGCGTGTGGAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_006742.2-420s21c1
Sequence:CCGGGCTAAGTACAGGGCCAAGTTTCTCGAGAAACTTGGCCCTGTACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006742.2-1355s21c1
Sequence:CCGGCCGCTCCACACGCTCCAATAACTCGAGTTATTGGAGCGTGTGGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006742.2-1271s21c1
Sequence:CCGGGCACCGCTCCATATCCCAGAACTCGAGTTCTGGGATATGGAGCGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_006742.2-2759s21c1
Sequence:CCGGTCCCTTCACAGCATTAACCTTCTCGAGAAGGTTAATGCTGTGAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_006742.2-983s21c1
Sequence:CCGGCAAGCCATACACCAACTCAGTCTCGAGACTGAGTTGGTGTATGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173432
VALIDATED
PSKH1 MISSION shRNA Bacterial Glycerol Stock
protein serine kinase H1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173432.2-955s1c1
Sequence:CCGGCCTACACCAATTCCGTGGATACTCGAGTATCCACGGAATTGGTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173432.2-693s1c1
Sequence:CCGGGCCAAGGGTTCTTTCACTGAACTCGAGTTCAGTGAAAGAACCCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173432.2-428s1c1
Sequence:CCGGGTATGATATAAAGGCCCTAATCTCGAGATTAGGGCCTTTATATCATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173432.2-1385s1c1
Sequence:CCGGGCGCTATCAACAGCAGTATAACTCGAGTTATACTGCTGTTGATAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173432.2-1225s1c1
Sequence:CCGGCCATGAAGAATCTGCACCGATCTCGAGATCGGTGCAGATTCTTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173432.2-387s21c1
Sequence:CCGGGCAAAGTACAGGGCCAAATTTCTCGAGAAATTTGGCCCTGTACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173432.2-429s21c1
Sequence:CCGGTATGATATAAAGGCCCTAATTCTCGAGAATTAGGGCCTTTATATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173432.2-623s21c1
Sequence:CCGGTGAGACACAGGAGCGTGTATACTCGAGTATACACGCTCCTGTGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173432.2-672s21c1
Sequence:CCGGGAGCTCTTTGACCGGATTATTCTCGAGAATAATCCGGTCAAAGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173432
VALIDATED
PSKH1 MISSION shRNA shRNA Plasmid DNA
protein serine kinase H1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173432.2-955s1c1
Sequence:CCGGCCTACACCAATTCCGTGGATACTCGAGTATCCACGGAATTGGTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173432.2-693s1c1
Sequence:CCGGGCCAAGGGTTCTTTCACTGAACTCGAGTTCAGTGAAAGAACCCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173432.2-428s1c1
Sequence:CCGGGTATGATATAAAGGCCCTAATCTCGAGATTAGGGCCTTTATATCATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173432.2-1385s1c1
Sequence:CCGGGCGCTATCAACAGCAGTATAACTCGAGTTATACTGCTGTTGATAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173432.2-1225s1c1
Sequence:CCGGCCATGAAGAATCTGCACCGATCTCGAGATCGGTGCAGATTCTTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173432.2-387s21c1
Sequence:CCGGGCAAAGTACAGGGCCAAATTTCTCGAGAAATTTGGCCCTGTACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173432.2-429s21c1
Sequence:CCGGTATGATATAAAGGCCCTAATTCTCGAGAATTAGGGCCTTTATATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173432.2-623s21c1
Sequence:CCGGTGAGACACAGGAGCGTGTATACTCGAGTATACACGCTCCTGTGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173432.2-672s21c1
Sequence:CCGGGAGCTCTTTGACCGGATTATTCTCGAGAATAATCCGGTCAAAGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173432
VALIDATED
PSKH1 MISSION shRNA Lentiviral Transduction Particles
protein serine kinase H1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173432.2-955s1c1
Sequence:CCGGCCTACACCAATTCCGTGGATACTCGAGTATCCACGGAATTGGTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173432.2-693s1c1
Sequence:CCGGGCCAAGGGTTCTTTCACTGAACTCGAGTTCAGTGAAAGAACCCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173432.2-428s1c1
Sequence:CCGGGTATGATATAAAGGCCCTAATCTCGAGATTAGGGCCTTTATATCATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173432.2-1385s1c1
Sequence:CCGGGCGCTATCAACAGCAGTATAACTCGAGTTATACTGCTGTTGATAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173432.2-1225s1c1
Sequence:CCGGCCATGAAGAATCTGCACCGATCTCGAGATCGGTGCAGATTCTTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173432.2-387s21c1
Sequence:CCGGGCAAAGTACAGGGCCAAATTTCTCGAGAAATTTGGCCCTGTACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173432.2-429s21c1
Sequence:CCGGTATGATATAAAGGCCCTAATTCTCGAGAATTAGGGCCTTTATATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173432.2-623s21c1
Sequence:CCGGTGAGACACAGGAGCGTGTATACTCGAGTATACACGCTCCTGTGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173432.2-672s21c1
Sequence:CCGGGAGCTCTTTGACCGGATTATTCTCGAGAATAATCCGGTCAAAGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks