EMAIL THIS PAGE TO A FRIEND

PSMA5

proteasome (prosome, macropain) subunit, alpha type, 5

Synonyms: PSC5 ZETA
UniProtKB ID: P28066, B2R8F6, B4E2V4, Q3T1C1, Q6IBF7
Gene ID:
Human(5686) Summary: The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Multiple alternatively spliced transcript variants encoding two distinct isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
Mouse(26442) proteasome (prosome, macropain) subunit, alpha type 5
Rat(29672) proteasome (prosome, macropain) subunit, alpha type 5
cow(510155) proteasome (prosome, macropain) subunit, alpha type, 5
sheep(101104946) proteasome (prosome, macropain) subunit, alpha type, 5
naked mole-rat(101699124) proteasome (prosome, macropain) subunit, alpha type, 5
domestic guinea pig(100730312) proteasome (prosome, macropain) subunit, alpha type, 5
Zebrafish(403011) proteasome (prosome, macropain) subunit, alpha type,5
chicken(426937) proteasome (prosome, macropain) subunit, alpha type, 5
domestic cat(101098808) proteasome (prosome, macropain) subunit, alpha type, 5
dog(490123) proteasome (prosome, macropain) subunit, alpha type, 5
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002790 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002790 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002790 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011967 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011967 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011967 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU043991 MISSION® esiRNA esiRNA human PSMA5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002790 Rosetta Predictions human pricing
NM_017282 Rosetta Predictions rat pricing
NM_011967 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002790 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145149 predicted 318
2 SASI_Hs01_00145150 predicted 483
3 SASI_Hs01_00145152 predicted 557
4 SASI_Hs01_00145153 predicted 486
5 SASI_Hs02_00334439 predicted 225
6 SASI_Hs01_00145154 predicted 295
7 SASI_Hs01_00145155 predicted 576
8 SASI_Hs01_00145157 predicted 669
9 SASI_Hs01_00145158 predicted 323
10 SASI_Hs02_00334440 predicted 577
11 SASI_Hs01_00145151 predicted 341
12 SASI_Hs01_00145156 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017282 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035936 predicted 202
2 SASI_Rn01_00035937 predicted 372
3 SASI_Rn01_00035938 predicted 289
4 SASI_Rn02_00261701 predicted 387
5 SASI_Rn01_00035939 predicted 365
6 SASI_Rn01_00035940 predicted 549
7 SASI_Rn01_00035942 predicted 615
8 SASI_Rn01_00035943 predicted 482
9 SASI_Rn02_00261702 predicted 259
10 SASI_Rn01_00035944 predicted 395
11 SASI_Rn01_00035941 predicted 574
12 SASI_Rn01_00035945 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011967 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321851 predicted 588
2 SASI_Mm01_00160392 predicted 839
3 SASI_Mm02_00321852 predicted 476
4 SASI_Mm01_00160397 predicted 927
5 SASI_Mm01_00160388 predicted 664
6 SASI_Mm02_00321853 predicted 549
7 SASI_Mm02_00321854 predicted 477
8 SASI_Mm02_00321855 predicted 435
9 SASI_Mm01_00160394 predicted 561
10 SASI_Mm01_00160396 predicted 549
11 SASI_Mm01_00160389 predicted 661
12 SASI_Mm01_00160390 predicted 534
13 SASI_Mm01_00160391 predicted 355
14 SASI_Mm01_00160393 predicted 466
15 SASI_Mm01_00160395 predicted 533
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002790
VALIDATED
PSMA5 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, alpha type, 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002790.x-790s1c1
Sequence:CCGGAGAGGTTATCAAGGACATTTACTCGAGTAAATGTCCTTGATAACCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002790.x-503s1c1
Sequence:CCGGGCATTATTATTTGGAGGAGTTCTCGAGAACTCCTCCAAATAATAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002790.x-492s1c1
Sequence:CCGGCCTTTGGAGTAGCATTATTATCTCGAGATAATAATGCTACTCCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002790.x-677s1c1
Sequence:CCGGTCACTCATCATCCTCAAACAACTCGAGTTGTTTGAGGATGATGAGTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002790.x-322s1c1
Sequence:CCGGTGGGCTAATTGCTGATGCTAACTCGAGTTAGCATCAGCAATTAGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002790.2-378s21c1
Sequence:CCGGACCACTGGTTCACCTACAATGCTCGAGCATTGTAGGTGAACCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002790.2-132s21c1
Sequence:CCGGCTCCCGAAGGAAGATTATTTCCTCGAGGAAATAATCTTCCTTCGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293176    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002790.2-839s21c1
Sequence:CCGGGGACAATTTCAGTTCTAATAACTCGAGTTATTAGAACTGAAATTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002790.2-492s21c1
Sequence:CCGGCCTTTGGAGTAGCATTATTATCTCGAGATAATAATGCTACTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002790.2-322s21c1
Sequence:CCGGTGGGCTAATTGCTGATGCTAACTCGAGTTAGCATCAGCAATTAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002790
VALIDATED
PSMA5 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, alpha type, 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002790.x-790s1c1
Sequence:CCGGAGAGGTTATCAAGGACATTTACTCGAGTAAATGTCCTTGATAACCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002790.x-503s1c1
Sequence:CCGGGCATTATTATTTGGAGGAGTTCTCGAGAACTCCTCCAAATAATAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002790.x-492s1c1
Sequence:CCGGCCTTTGGAGTAGCATTATTATCTCGAGATAATAATGCTACTCCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002790.x-677s1c1
Sequence:CCGGTCACTCATCATCCTCAAACAACTCGAGTTGTTTGAGGATGATGAGTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002790.x-322s1c1
Sequence:CCGGTGGGCTAATTGCTGATGCTAACTCGAGTTAGCATCAGCAATTAGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002790.2-378s21c1
Sequence:CCGGACCACTGGTTCACCTACAATGCTCGAGCATTGTAGGTGAACCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002790.2-132s21c1
Sequence:CCGGCTCCCGAAGGAAGATTATTTCCTCGAGGAAATAATCTTCCTTCGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293176    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002790.2-839s21c1
Sequence:CCGGGGACAATTTCAGTTCTAATAACTCGAGTTATTAGAACTGAAATTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002790.2-492s21c1
Sequence:CCGGCCTTTGGAGTAGCATTATTATCTCGAGATAATAATGCTACTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002790.2-322s21c1
Sequence:CCGGTGGGCTAATTGCTGATGCTAACTCGAGTTAGCATCAGCAATTAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002790
VALIDATED
PSMA5 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, alpha type, 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002790.x-790s1c1
Sequence:CCGGAGAGGTTATCAAGGACATTTACTCGAGTAAATGTCCTTGATAACCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002790.x-503s1c1
Sequence:CCGGGCATTATTATTTGGAGGAGTTCTCGAGAACTCCTCCAAATAATAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002790.x-492s1c1
Sequence:CCGGCCTTTGGAGTAGCATTATTATCTCGAGATAATAATGCTACTCCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002790.x-677s1c1
Sequence:CCGGTCACTCATCATCCTCAAACAACTCGAGTTGTTTGAGGATGATGAGTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002790.x-322s1c1
Sequence:CCGGTGGGCTAATTGCTGATGCTAACTCGAGTTAGCATCAGCAATTAGCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002790.2-378s21c1
Sequence:CCGGACCACTGGTTCACCTACAATGCTCGAGCATTGTAGGTGAACCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002790.2-132s21c1
Sequence:CCGGCTCCCGAAGGAAGATTATTTCCTCGAGGAAATAATCTTCCTTCGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293176    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002790.2-839s21c1
Sequence:CCGGGGACAATTTCAGTTCTAATAACTCGAGTTATTAGAACTGAAATTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002790.2-492s21c1
Sequence:CCGGCCTTTGGAGTAGCATTATTATCTCGAGATAATAATGCTACTCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002790.2-322s21c1
Sequence:CCGGTGGGCTAATTGCTGATGCTAACTCGAGTTAGCATCAGCAATTAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011967
VALIDATED
PSMA5 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) subunit, alpha type, 5
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011967.1-247s1c1
Sequence:CCGGCCTAGCAGCATTGAGAAGATTCTCGAGAATCTTCTCAATGCTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011967.1-621s1c1
Sequence:CCGGCCATAAGTCTATGACTCTGAACTCGAGTTCAGAGTCATAGACTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011967.1-801s1c1
Sequence:CCGGCGTCCTCGAACTTCTGTGGGACTCGAGTCCCACAGAAGTTCGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011967.3-1008s21c1
Sequence:CCGGGGTGCAGCCTGGTCAGAATTTCTCGAGAAATTCTGACCAGGCTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011967.3-761s21c1
Sequence:CCGGTTGGAGTAGCATTGTTGTTTGCTCGAGCAAACAACAATGCTACTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011967.3-397s21c1
Sequence:CCGGTCTCCTGAAGGAAGATTATTTCTCGAGAAATAATCTTCCTTCAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011967.3-426s21c1
Sequence:CCGGATATGCCATTGAGGCTATCAACTCGAGTTGATAGCCTCAATGGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011967.3-553s21c1
Sequence:CCGGGTAGAGATCGATGCTCATATACTCGAGTATATGAGCATCGATCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011967.3-642s21c1
Sequence:CCGGGAACCACTGGTTCACCTATAACTCGAGTTATAGGTGAACCAGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011967.3-577s21c1
Sequence:CCGGTGTGCCATGAGTGGGCTAATTCTCGAGAATTAGCCCACTCATGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011967.3-898s21c1
Sequence:CCGGGAAGTTTACCATAAGTCTATGCTCGAGCATAGACTTATGGTAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011967
VALIDATED
PSMA5 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) subunit, alpha type, 5
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011967.1-247s1c1
Sequence:CCGGCCTAGCAGCATTGAGAAGATTCTCGAGAATCTTCTCAATGCTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011967.1-621s1c1
Sequence:CCGGCCATAAGTCTATGACTCTGAACTCGAGTTCAGAGTCATAGACTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011967.1-801s1c1
Sequence:CCGGCGTCCTCGAACTTCTGTGGGACTCGAGTCCCACAGAAGTTCGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011967.3-1008s21c1
Sequence:CCGGGGTGCAGCCTGGTCAGAATTTCTCGAGAAATTCTGACCAGGCTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011967.3-761s21c1
Sequence:CCGGTTGGAGTAGCATTGTTGTTTGCTCGAGCAAACAACAATGCTACTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011967.3-397s21c1
Sequence:CCGGTCTCCTGAAGGAAGATTATTTCTCGAGAAATAATCTTCCTTCAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011967.3-426s21c1
Sequence:CCGGATATGCCATTGAGGCTATCAACTCGAGTTGATAGCCTCAATGGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011967.3-553s21c1
Sequence:CCGGGTAGAGATCGATGCTCATATACTCGAGTATATGAGCATCGATCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011967.3-642s21c1
Sequence:CCGGGAACCACTGGTTCACCTATAACTCGAGTTATAGGTGAACCAGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011967.3-577s21c1
Sequence:CCGGTGTGCCATGAGTGGGCTAATTCTCGAGAATTAGCCCACTCATGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011967.3-898s21c1
Sequence:CCGGGAAGTTTACCATAAGTCTATGCTCGAGCATAGACTTATGGTAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011967
VALIDATED
PSMA5 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) subunit, alpha type, 5
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011967.1-247s1c1
Sequence:CCGGCCTAGCAGCATTGAGAAGATTCTCGAGAATCTTCTCAATGCTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011967.1-621s1c1
Sequence:CCGGCCATAAGTCTATGACTCTGAACTCGAGTTCAGAGTCATAGACTTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032159    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011967.1-801s1c1
Sequence:CCGGCGTCCTCGAACTTCTGTGGGACTCGAGTCCCACAGAAGTTCGAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011967.3-1008s21c1
Sequence:CCGGGGTGCAGCCTGGTCAGAATTTCTCGAGAAATTCTGACCAGGCTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011967.3-761s21c1
Sequence:CCGGTTGGAGTAGCATTGTTGTTTGCTCGAGCAAACAACAATGCTACTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011967.3-397s21c1
Sequence:CCGGTCTCCTGAAGGAAGATTATTTCTCGAGAAATAATCTTCCTTCAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011967.3-426s21c1
Sequence:CCGGATATGCCATTGAGGCTATCAACTCGAGTTGATAGCCTCAATGGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011967.3-553s21c1
Sequence:CCGGGTAGAGATCGATGCTCATATACTCGAGTATATGAGCATCGATCTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011967.3-642s21c1
Sequence:CCGGGAACCACTGGTTCACCTATAACTCGAGTTATAGGTGAACCAGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011967.3-577s21c1
Sequence:CCGGTGTGCCATGAGTGGGCTAATTCTCGAGAATTAGCCCACTCATGGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011967.3-898s21c1
Sequence:CCGGGAAGTTTACCATAAGTCTATGCTCGAGCATAGACTTATGGTAAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks