EMAIL THIS PAGE TO A FRIEND

PSMD7

proteasome (prosome, macropain) 26S subunit, non-ATPase, 7

Synonyms: MOV34 P40 Rpn8 S12
UniProtKB ID: P51665, D3DWS9, Q6PKI2, Q96E97
Gene ID:
Human(5713) Summary: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. A pseudogene has been identified on chromosome 17. [provided by RefSeq, Jul 2008]
Mouse(17463) proteasome (prosome, macropain) 26S subunit, non-ATPase, 7
Rat(307821) proteasome (prosome, macropain) 26S subunit, non-ATPase, 7
Zebrafish(327330) proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog)
dog(479671) proteasome (prosome, macropain) 26S subunit, non-ATPase, 7
domestic cat(101098912) proteasome (prosome, macropain) 26S subunit, non-ATPase, 7
chicken(415869) proteasome (prosome, macropain) 26S subunit, non-ATPase, 7
domestic guinea pig(100720798) proteasome (prosome, macropain) 26S subunit, non-ATPase, 7
naked mole-rat(101709806) proteasome (prosome, macropain) 26S subunit, non-ATPase, 7
cow(512456) proteasome (prosome, macropain) 26S subunit, non-ATPase, 7
sheep(101122881) proteasome (prosome, macropain) 26S subunit, non-ATPase, 7
100 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010817 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010817 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010817 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002811 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002811 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002811 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002811 Rosetta Predictions human pricing
NM_001107426 Rosetta Predictions rat pricing
NM_010817 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002811 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334491 predicted 230
2 SASI_Hs02_00334492 predicted 645
3 SASI_Hs02_00334493 predicted 268
4 SASI_Hs01_00064752 predicted 623
5 SASI_Hs01_00064753 predicted 529
6 SASI_Hs01_00064755 predicted 472
7 SASI_Hs01_00064757 predicted 374
8 SASI_Hs01_00064758 predicted 479
9 SASI_Hs02_00334494 predicted 357
10 SASI_Hs02_00334495 predicted 537
11 SASI_Hs01_00064750 predicted 702
12 SASI_Hs01_00064751 predicted 453
13 SASI_Hs01_00064754 predicted 521
14 SASI_Hs01_00064756 predicted 422
15 SASI_Hs01_00064759 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107426 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228705 predicted 1308
2 SASI_Rn02_00228706 predicted 526
3 SASI_Rn02_00228707 predicted 479
4 SASI_Rn02_00228708 predicted 334
5 SASI_Rn02_00228709 predicted 377
6 SASI_Rn02_00228710 predicted 725
7 SASI_Rn02_00228711 predicted 709
8 SASI_Rn02_00228712 predicted 533
9 SASI_Rn02_00228713 predicted 362
10 SASI_Rn02_00228714 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010817 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319419 predicted 521
2 SASI_Mm01_00053910 predicted 710
3 SASI_Mm01_00053911 predicted 443
4 SASI_Mm01_00053912 predicted 704
5 SASI_Mm01_00053913 predicted 526
6 SASI_Mm01_00053914 predicted 592
7 SASI_Mm01_00053915 predicted 564
8 SASI_Mm01_00053916 predicted 510
9 SASI_Mm01_00053917 predicted 362
10 SASI_Mm01_00053918 predicted 337
11 SASI_Mm01_00053919 predicted 735
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010817
PSMD7 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010817.1-649s21c1
Sequence:CCGGGCACTTACTAAGAGACATCAACTCGAGTTGATGTCTCTTAGTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010817.1-271s21c1
Sequence:CCGGACTTGATGTATCCAACAGTTTCTCGAGAAACTGTTGGATACATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010817.1-880s21c1
Sequence:CCGGCCTGAAGACCAATGACCAGATCTCGAGATCTGGTCATTGGTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010817.1-946s21c1
Sequence:CCGGGCATAACCTCATCAACAACAACTCGAGTTGTTGTTGATGAGGTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010817.1-479s21c1
Sequence:CCGGCCCAACTCAGTATTGGTCATTCTCGAGAATGACCAATACTGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010817.1-649s1c1
Sequence:CCGGGCACTTACTAAGAGACATCAACTCGAGTTGATGTCTCTTAGTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010817.1-479s1c1
Sequence:CCGGCCCAACTCAGTATTGGTCATTCTCGAGAATGACCAATACTGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010817.1-946s1c1
Sequence:CCGGGCATAACCTCATCAACAACAACTCGAGTTGTTGTTGATGAGGTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010817.1-271s1c1
Sequence:CCGGACTTGATGTATCCAACAGTTTCTCGAGAAACTGTTGGATACATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010817.1-880s1c1
Sequence:CCGGCCTGAAGACCAATGACCAGATCTCGAGATCTGGTCATTGGTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010817
PSMD7 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010817.1-649s21c1
Sequence:CCGGGCACTTACTAAGAGACATCAACTCGAGTTGATGTCTCTTAGTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010817.1-271s21c1
Sequence:CCGGACTTGATGTATCCAACAGTTTCTCGAGAAACTGTTGGATACATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010817.1-880s21c1
Sequence:CCGGCCTGAAGACCAATGACCAGATCTCGAGATCTGGTCATTGGTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010817.1-946s21c1
Sequence:CCGGGCATAACCTCATCAACAACAACTCGAGTTGTTGTTGATGAGGTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010817.1-479s21c1
Sequence:CCGGCCCAACTCAGTATTGGTCATTCTCGAGAATGACCAATACTGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010817.1-649s1c1
Sequence:CCGGGCACTTACTAAGAGACATCAACTCGAGTTGATGTCTCTTAGTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010817.1-479s1c1
Sequence:CCGGCCCAACTCAGTATTGGTCATTCTCGAGAATGACCAATACTGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010817.1-946s1c1
Sequence:CCGGGCATAACCTCATCAACAACAACTCGAGTTGTTGTTGATGAGGTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010817.1-271s1c1
Sequence:CCGGACTTGATGTATCCAACAGTTTCTCGAGAAACTGTTGGATACATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010817.1-880s1c1
Sequence:CCGGCCTGAAGACCAATGACCAGATCTCGAGATCTGGTCATTGGTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010817
PSMD7 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010817.1-649s21c1
Sequence:CCGGGCACTTACTAAGAGACATCAACTCGAGTTGATGTCTCTTAGTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010817.1-271s21c1
Sequence:CCGGACTTGATGTATCCAACAGTTTCTCGAGAAACTGTTGGATACATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010817.1-880s21c1
Sequence:CCGGCCTGAAGACCAATGACCAGATCTCGAGATCTGGTCATTGGTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010817.1-946s21c1
Sequence:CCGGGCATAACCTCATCAACAACAACTCGAGTTGTTGTTGATGAGGTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010817.1-479s21c1
Sequence:CCGGCCCAACTCAGTATTGGTCATTCTCGAGAATGACCAATACTGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010817.1-649s1c1
Sequence:CCGGGCACTTACTAAGAGACATCAACTCGAGTTGATGTCTCTTAGTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010817.1-479s1c1
Sequence:CCGGCCCAACTCAGTATTGGTCATTCTCGAGAATGACCAATACTGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010817.1-946s1c1
Sequence:CCGGGCATAACCTCATCAACAACAACTCGAGTTGTTGTTGATGAGGTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010817.1-271s1c1
Sequence:CCGGACTTGATGTATCCAACAGTTTCTCGAGAAACTGTTGGATACATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010817.1-880s1c1
Sequence:CCGGCCTGAAGACCAATGACCAGATCTCGAGATCTGGTCATTGGTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002811
PSMD7 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002811.3-451s21c1
Sequence:CCGGGCCATCAACGAACTCATGAAACTCGAGTTTCATGAGTTCGTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002811.3-485s21c1
Sequence:CCGGATTCCGTATTGGTCATCATTGCTCGAGCAATGATGACCAATACGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002811.3-1185s21c1
Sequence:CCGGTTTCACTTGACATGCTTATTACTCGAGTAATAAGCATGTCAAGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002811.3-180s21c1
Sequence:CCGGGCTCAGTGTGGTGGATCATTTCTCGAGAAATGATCCACCACACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002811.3-631s21c1
Sequence:CCGGGCTGAGGAAGTTGGAGTTGAACTCGAGTTCAACTCCAACTTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002811.3-451s1c1
Sequence:CCGGGCCATCAACGAACTCATGAAACTCGAGTTTCATGAGTTCGTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002811.3-945s1c1
Sequence:CCGGCCTGCACAACCTCATCAACAACTCGAGTTGTTGATGAGGTTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002811.3-313s1c1
Sequence:CCGGGATGACAAAGACGATTCTGTACTCGAGTACAGAATCGTCTTTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002811
PSMD7 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002811.3-451s21c1
Sequence:CCGGGCCATCAACGAACTCATGAAACTCGAGTTTCATGAGTTCGTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002811.3-485s21c1
Sequence:CCGGATTCCGTATTGGTCATCATTGCTCGAGCAATGATGACCAATACGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002811.3-1185s21c1
Sequence:CCGGTTTCACTTGACATGCTTATTACTCGAGTAATAAGCATGTCAAGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002811.3-180s21c1
Sequence:CCGGGCTCAGTGTGGTGGATCATTTCTCGAGAAATGATCCACCACACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002811.3-631s21c1
Sequence:CCGGGCTGAGGAAGTTGGAGTTGAACTCGAGTTCAACTCCAACTTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002811.3-451s1c1
Sequence:CCGGGCCATCAACGAACTCATGAAACTCGAGTTTCATGAGTTCGTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002811.3-945s1c1
Sequence:CCGGCCTGCACAACCTCATCAACAACTCGAGTTGTTGATGAGGTTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002811.3-313s1c1
Sequence:CCGGGATGACAAAGACGATTCTGTACTCGAGTACAGAATCGTCTTTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002811
PSMD7 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, non-ATPase, 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002811.3-451s21c1
Sequence:CCGGGCCATCAACGAACTCATGAAACTCGAGTTTCATGAGTTCGTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002811.3-485s21c1
Sequence:CCGGATTCCGTATTGGTCATCATTGCTCGAGCAATGATGACCAATACGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296470    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002811.3-1185s21c1
Sequence:CCGGTTTCACTTGACATGCTTATTACTCGAGTAATAAGCATGTCAAGTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002811.3-180s21c1
Sequence:CCGGGCTCAGTGTGGTGGATCATTTCTCGAGAAATGATCCACCACACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002811.3-631s21c1
Sequence:CCGGGCTGAGGAAGTTGGAGTTGAACTCGAGTTCAACTCCAACTTCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002811.3-451s1c1
Sequence:CCGGGCCATCAACGAACTCATGAAACTCGAGTTTCATGAGTTCGTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002811.3-945s1c1
Sequence:CCGGCCTGCACAACCTCATCAACAACTCGAGTTGTTGATGAGGTTGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002811.3-313s1c1
Sequence:CCGGGATGACAAAGACGATTCTGTACTCGAGTACAGAATCGTCTTTGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks