EMAIL THIS PAGE TO A FRIEND

PSMD9

proteasome (prosome, macropain) 26S subunit, non-ATPase, 9

Synonyms: Rpn4 p27
UniProtKB ID: O00233, B2RD35, G3V1Q6, Q9BQ42
Gene ID:
Human(5715) Summary: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, May 2012]
Mouse(67151) proteasome (prosome, macropain) 26S subunit, non-ATPase, 9
Rat(161475) proteasome (prosome, macropain) 26S subunit, non-ATPase, 9
Zebrafish(436709) proteasome (prosome, macropain) 26S subunit, non-ATPase, 9
chicken(416853) proteasome (prosome, macropain) 26S subunit, non-ATPase, 9
dog(477467) proteasome (prosome, macropain) 26S subunit, non-ATPase, 9
domestic cat(101093051) proteasome (prosome, macropain) 26S subunit, non-ATPase, 9
domestic guinea pig(100725263) proteasome (prosome, macropain) 26S subunit, non-ATPase, 9
naked mole-rat(101704885) proteasome (prosome, macropain) 26S subunit, non-ATPase, 9
cow(513315) proteasome (prosome, macropain) 26S subunit, non-ATPase, 9
sheep(101122384) proteasome (prosome, macropain) 26S subunit, non-ATPase, 9
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002813 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002813 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002813 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026000 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026000 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026000 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002813 Rosetta Predictions human pricing
NM_130430 Rosetta Predictions rat pricing
NM_026000 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002813 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056963 predicted 232
2 SASI_Hs01_00056964 predicted 471
3 SASI_Hs01_00056965 predicted 758
4 SASI_Hs01_00056966 predicted 831
5 SASI_Hs01_00056967 predicted 613
6 SASI_Hs01_00056968 predicted 853
7 SASI_Hs01_00056969 predicted 833
8 SASI_Hs01_00056970 predicted 551
9 SASI_Hs01_00056971 predicted 304
10 SASI_Hs01_00056972 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130430 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267443 predicted 597
2 SASI_Rn02_00267444 predicted 782
3 SASI_Rn02_00267445 predicted 1118
4 SASI_Rn02_00267446 predicted 680
5 SASI_Rn02_00267447 predicted 687
6 SASI_Rn02_00267448 predicted 698
7 SASI_Rn02_00267449 predicted 938
8 SASI_Rn02_00267450 predicted 732
9 SASI_Rn02_00267451 predicted 718
10 SASI_Rn02_00267452 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026000 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166034 predicted 839
2 SASI_Mm01_00166035 predicted 594
3 SASI_Mm01_00166036 predicted 1019
4 SASI_Mm01_00166037 predicted 935
5 SASI_Mm01_00166038 predicted 1009
6 SASI_Mm02_00329461 predicted 754
7 SASI_Mm02_00329462 predicted 213
8 SASI_Mm01_00166040 predicted 566
9 SASI_Mm01_00166041 predicted 323
10 SASI_Mm01_00166042 predicted 989
11 SASI_Mm01_00166039 predicted 813
12 SASI_Mm01_00166043 predicted 309
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002813
VALIDATED
PSMD9 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002813.4-1231s21c1
Sequence:CCGGGTCAGGCTTTGACCAACATATCTCGAGATATGTTGGTCAAAGCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_002813.4-199s21c1
Sequence:CCGGCGGCGCAAGGAGGAGATAGAACTCGAGTTCTATCTCCTCCTTGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002813.4-220s21c1
Sequence:CCGGGCGCAGATCAAGGCCAACTATCTCGAGATAGTTGGCCTTGATCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369096    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002813.4-1064s21c1
Sequence:CCGGAGGTACTGGTGTGATTATTATCTCGAGATAATAATCACACCAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_002813.4-713s21c1
Sequence:CCGGACCAGCTTAGACTTGTTCCAACTCGAGTTGGAACAAGTCTAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002813.x-199s1c1
Sequence:CCGGCGGCGCAAGGAGGAGATAGAACTCGAGTTCTATCTCCTCCTTGCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002813.x-220s1c1
Sequence:CCGGGCGCAGATCAAGGCCAACTATCTCGAGATAGTTGGCCTTGATCTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002813.x-2267s1c1
Sequence:CCGGGCATGTTCTAATTCCACGTATCTCGAGATACGTGGAATTAGAACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002813.x-713s1c1
Sequence:CCGGACCAGCTTAGACTTGTTCCAACTCGAGTTGGAACAAGTCTAAGCTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002813.x-568s1c1
Sequence:CCGGGCGGGTCTGCAAGTGGATGATCTCGAGATCATCCACTTGCAGACCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002813
VALIDATED
PSMD9 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002813.4-1231s21c1
Sequence:CCGGGTCAGGCTTTGACCAACATATCTCGAGATATGTTGGTCAAAGCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_002813.4-199s21c1
Sequence:CCGGCGGCGCAAGGAGGAGATAGAACTCGAGTTCTATCTCCTCCTTGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002813.4-220s21c1
Sequence:CCGGGCGCAGATCAAGGCCAACTATCTCGAGATAGTTGGCCTTGATCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369096    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002813.4-1064s21c1
Sequence:CCGGAGGTACTGGTGTGATTATTATCTCGAGATAATAATCACACCAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_002813.4-713s21c1
Sequence:CCGGACCAGCTTAGACTTGTTCCAACTCGAGTTGGAACAAGTCTAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002813.x-199s1c1
Sequence:CCGGCGGCGCAAGGAGGAGATAGAACTCGAGTTCTATCTCCTCCTTGCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002813.x-220s1c1
Sequence:CCGGGCGCAGATCAAGGCCAACTATCTCGAGATAGTTGGCCTTGATCTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002813.x-2267s1c1
Sequence:CCGGGCATGTTCTAATTCCACGTATCTCGAGATACGTGGAATTAGAACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002813.x-713s1c1
Sequence:CCGGACCAGCTTAGACTTGTTCCAACTCGAGTTGGAACAAGTCTAAGCTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002813.x-568s1c1
Sequence:CCGGGCGGGTCTGCAAGTGGATGATCTCGAGATCATCCACTTGCAGACCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002813
VALIDATED
PSMD9 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002813.4-1231s21c1
Sequence:CCGGGTCAGGCTTTGACCAACATATCTCGAGATATGTTGGTCAAAGCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_002813.4-199s21c1
Sequence:CCGGCGGCGCAAGGAGGAGATAGAACTCGAGTTCTATCTCCTCCTTGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002813.4-220s21c1
Sequence:CCGGGCGCAGATCAAGGCCAACTATCTCGAGATAGTTGGCCTTGATCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369096    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002813.4-1064s21c1
Sequence:CCGGAGGTACTGGTGTGATTATTATCTCGAGATAATAATCACACCAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_002813.4-713s21c1
Sequence:CCGGACCAGCTTAGACTTGTTCCAACTCGAGTTGGAACAAGTCTAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002813.x-199s1c1
Sequence:CCGGCGGCGCAAGGAGGAGATAGAACTCGAGTTCTATCTCCTCCTTGCGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002813.x-220s1c1
Sequence:CCGGGCGCAGATCAAGGCCAACTATCTCGAGATAGTTGGCCTTGATCTGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002813.x-2267s1c1
Sequence:CCGGGCATGTTCTAATTCCACGTATCTCGAGATACGTGGAATTAGAACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002813.x-713s1c1
Sequence:CCGGACCAGCTTAGACTTGTTCCAACTCGAGTTGGAACAAGTCTAAGCTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002813.x-568s1c1
Sequence:CCGGGCGGGTCTGCAAGTGGATGATCTCGAGATCATCCACTTGCAGACCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026000
VALIDATED
PSMD9 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026000.1-707s1c1
Sequence:CCGGGCAACATTATTCCTCTCCAGACTCGAGTCTGGAGAGGAATAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026000.1-463s1c1
Sequence:CCGGCGTTTGCCAGAGTGAACAGTACTCGAGTACTGTTCACTCTGGCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026000.1-278s1c1
Sequence:CCGGCCGAACAGCAAGGCACAACATCTCGAGATGTTGTGCCTTGCTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026000.1-131s1c1
Sequence:CCGGCCAGGATCTGATGCGACGCAACTCGAGTTGCGTCGCATCAGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026000.1-726s1c1
Sequence:CCGGGAGATGACTGTTTCCTGGGATCTCGAGATCCCAGGAAACAGTCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026000
VALIDATED
PSMD9 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026000.1-707s1c1
Sequence:CCGGGCAACATTATTCCTCTCCAGACTCGAGTCTGGAGAGGAATAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026000.1-463s1c1
Sequence:CCGGCGTTTGCCAGAGTGAACAGTACTCGAGTACTGTTCACTCTGGCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026000.1-278s1c1
Sequence:CCGGCCGAACAGCAAGGCACAACATCTCGAGATGTTGTGCCTTGCTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026000.1-131s1c1
Sequence:CCGGCCAGGATCTGATGCGACGCAACTCGAGTTGCGTCGCATCAGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026000.1-726s1c1
Sequence:CCGGGAGATGACTGTTTCCTGGGATCTCGAGATCCCAGGAAACAGTCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026000
VALIDATED
PSMD9 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) 26S subunit, non-ATPase, 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026000.1-707s1c1
Sequence:CCGGGCAACATTATTCCTCTCCAGACTCGAGTCTGGAGAGGAATAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026000.1-463s1c1
Sequence:CCGGCGTTTGCCAGAGTGAACAGTACTCGAGTACTGTTCACTCTGGCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026000.1-278s1c1
Sequence:CCGGCCGAACAGCAAGGCACAACATCTCGAGATGTTGTGCCTTGCTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026000.1-131s1c1
Sequence:CCGGCCAGGATCTGATGCGACGCAACTCGAGTTGCGTCGCATCAGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026000.1-726s1c1
Sequence:CCGGGAGATGACTGTTTCCTGGGATCTCGAGATCCCAGGAAACAGTCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks