EMAIL THIS PAGE TO A FRIEND

PSME3

proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)

Synonyms: Ki PA28-gamma PA28G PA28gamma REG-GAMMA
Gene ID:
Human(10197) Summary: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. This gene encodes the gamma subunit of the 11S regulator. Six gamma subunits combine to form a homohexameric ring. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
Mouse(19192) proteaseome (prosome, macropain) activator subunit 3 (PA28 gamma, Ki)
Rat(287716) proteasome (prosome, macropain) activator subunit 3
Zebrafish(30649) proteasome activator subunit 3
domestic cat(101101426) proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)
dog(480512) proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)
chicken(420017) proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)
cow(100336105) proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)
sheep(101106185) proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)
naked mole-rat(101710384) proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)
domestic guinea pig(100721509) proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)
189 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV46142 Anti-PSME3 (AB1) antibody produced in rabbit affinity isolated antibody rabbit, human, horse, bovine, mouse, rat, guinea pig, canine
immunohistochemistry, western blot pricing
AV46143 Anti-PSME3 (AB2) antibody produced in rabbit IgG fraction of antiserum guinea pig, horse, rat, rabbit, bovine, canine, pig, human, mouse
western blot pricing
SAB2500833 Anti-PSME3 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, mouse, canine, human
ELISA, western blot pricing
SAB1406944 Anti-PSME3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA012510 Anti-PSME3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005789 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005789 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005789 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011192 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011192 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011192 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005789 Rosetta Predictions human pricing
NM_176863 Rosetta Predictions human pricing
NM_001011894 Rosetta Predictions rat pricing
NM_011192 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005789 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135977 predicted 1361
2 SASI_Hs02_00340285 predicted 871
3 SASI_Hs01_00135979 predicted 1121
4 SASI_Hs02_00340286 predicted 1040
5 SASI_Hs01_00135980 predicted 327
6 SASI_Hs02_00340287 predicted 1136
7 SASI_Hs01_00135982 predicted 1333
8 SASI_Hs01_00135983 predicted 896
9 SASI_Hs01_00135984 predicted 906
10 SASI_Hs01_00135985 predicted 370
11 SASI_Hs01_00135978 predicted 1035
12 SASI_Hs01_00135981 predicted 1423
13 SASI_Hs01_00135986 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176863 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137661 predicted 1408
2 SASI_Hs02_00369254 predicted 911
3 SASI_Hs01_00137663 predicted 1161
4 SASI_Hs02_00369255 predicted 1083
5 SASI_Hs01_00137664 predicted 332
6 SASI_Hs02_00369256 predicted 1176
7 SASI_Hs01_00137666 predicted 1367
8 SASI_Hs01_00137667 predicted 935
9 SASI_Hs01_00137668 predicted 953
10 SASI_Hs01_00137669 predicted 363
11 SASI_Hs01_00137662 predicted 1074
12 SASI_Hs01_00137665 predicted 1456
13 SASI_Hs01_00137670 predicted 1181
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011894 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093989 predicted 672
2 SASI_Rn01_00093990 predicted 724
3 SASI_Rn01_00093992 predicted 711
4 SASI_Rn01_00093993 predicted 978
5 SASI_Rn01_00093994 predicted 303
6 SASI_Rn01_00093995 predicted 492
7 SASI_Rn01_00093997 predicted 688
8 SASI_Rn01_00093998 predicted 325
9 SASI_Rn02_00199873 predicted 703
10 SASI_Rn02_00199874 predicted 1008
11 SASI_Rn01_00093991 predicted 553
12 SASI_Rn01_00093996 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011192 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181207 predicted 666
2 SASI_Mm01_00181208 predicted 999
3 SASI_Mm02_00320106 predicted 667
4 SASI_Mm01_00181209 predicted 305
5 SASI_Mm01_00181210 predicted 717
6 SASI_Mm01_00181211 predicted 980
7 SASI_Mm01_00181212 predicted 1007
8 SASI_Mm01_00181213 predicted 487
9 SASI_Mm01_00181215 predicted 326
10 SASI_Mm01_00181216 predicted 789
11 SASI_Mm01_00181214 predicted 263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005789
VALIDATED
PSME3 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005789.2-485s1c1
Sequence:CCGGCGAAGGTTGGATGAGTGTGAACTCGAGTTCACACTCATCCAACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005789.2-841s1c1
Sequence:CCGGCGTGACAGAGATTGATGAGAACTCGAGTTCTCATCAATCTCTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005789.2-743s1c1
Sequence:CCGGGCATCTTATCTGGACCAGATTCTCGAGAATCTGGTCCAGATAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005789.2-365s1c1
Sequence:CCGGGAACCAATCTTAAACATCCATCTCGAGATGGATGTTTAAGATTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005789.2-617s1c1
Sequence:CCGGGAGAAATGTAACACGGTCAAACTCGAGTTTGACCGTGTTACATTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005789.2-743s21c1
Sequence:CCGGGCATCTTATCTGGACCAGATTCTCGAGAATCTGGTCCAGATAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005789.2-841s21c1
Sequence:CCGGCGTGACAGAGATTGATGAGAACTCGAGTTCTCATCAATCTCTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_005789.2-485s21c1
Sequence:CCGGCGAAGGTTGGATGAGTGTGAACTCGAGTTCACACTCATCCAACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_005789.2-1209s21c1
Sequence:CCGGACACCCAACCTGTCGTAATTTCTCGAGAAATTACGACAGGTTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005789.2-460s21c1
Sequence:CCGGACTGGATGGTCCCACTTATAACTCGAGTTATAAGTGGGACCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005789
VALIDATED
PSME3 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005789.2-485s1c1
Sequence:CCGGCGAAGGTTGGATGAGTGTGAACTCGAGTTCACACTCATCCAACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005789.2-841s1c1
Sequence:CCGGCGTGACAGAGATTGATGAGAACTCGAGTTCTCATCAATCTCTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005789.2-743s1c1
Sequence:CCGGGCATCTTATCTGGACCAGATTCTCGAGAATCTGGTCCAGATAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005789.2-365s1c1
Sequence:CCGGGAACCAATCTTAAACATCCATCTCGAGATGGATGTTTAAGATTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005789.2-617s1c1
Sequence:CCGGGAGAAATGTAACACGGTCAAACTCGAGTTTGACCGTGTTACATTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005789.2-743s21c1
Sequence:CCGGGCATCTTATCTGGACCAGATTCTCGAGAATCTGGTCCAGATAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005789.2-841s21c1
Sequence:CCGGCGTGACAGAGATTGATGAGAACTCGAGTTCTCATCAATCTCTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_005789.2-485s21c1
Sequence:CCGGCGAAGGTTGGATGAGTGTGAACTCGAGTTCACACTCATCCAACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_005789.2-1209s21c1
Sequence:CCGGACACCCAACCTGTCGTAATTTCTCGAGAAATTACGACAGGTTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005789.2-460s21c1
Sequence:CCGGACTGGATGGTCCCACTTATAACTCGAGTTATAAGTGGGACCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005789
VALIDATED
PSME3 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005789.2-485s1c1
Sequence:CCGGCGAAGGTTGGATGAGTGTGAACTCGAGTTCACACTCATCCAACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005789.2-841s1c1
Sequence:CCGGCGTGACAGAGATTGATGAGAACTCGAGTTCTCATCAATCTCTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005789.2-743s1c1
Sequence:CCGGGCATCTTATCTGGACCAGATTCTCGAGAATCTGGTCCAGATAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005789.2-365s1c1
Sequence:CCGGGAACCAATCTTAAACATCCATCTCGAGATGGATGTTTAAGATTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005789.2-617s1c1
Sequence:CCGGGAGAAATGTAACACGGTCAAACTCGAGTTTGACCGTGTTACATTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005789.2-743s21c1
Sequence:CCGGGCATCTTATCTGGACCAGATTCTCGAGAATCTGGTCCAGATAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005789.2-841s21c1
Sequence:CCGGCGTGACAGAGATTGATGAGAACTCGAGTTCTCATCAATCTCTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_005789.2-485s21c1
Sequence:CCGGCGAAGGTTGGATGAGTGTGAACTCGAGTTCACACTCATCCAACCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_005789.2-1209s21c1
Sequence:CCGGACACCCAACCTGTCGTAATTTCTCGAGAAATTACGACAGGTTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005789.2-460s21c1
Sequence:CCGGACTGGATGGTCCCACTTATAACTCGAGTTATAAGTGGGACCATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011192
VALIDATED
PSME3 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011192.2-586s1c1
Sequence:CCGGCGAGAAATGTAACACGGTCAACTCGAGTTGACCGTGTTACATTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011192.2-299s1c1
Sequence:CCGGCCAAAGAAGTTACTAGAACTTCTCGAGAAGTTCTAGTAACTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011192.2-806s1c1
Sequence:CCGGCGCACTGTCACAGAGATTGATCTCGAGATCAATCTCTGTGACAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011192.2-272s1c1
Sequence:CCGGGCAGAAGACTTGGTGGCAAATCTCGAGATTTGCCACCAAGTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011192.2-752s1c1
Sequence:CCGGAGAGCCAAATTGGTTTCTAAACTCGAGTTTAGAAACCAATTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011192.3-1224s21c1
Sequence:CCGGCATACTGGCACAAGCGTAATTCTCGAGAATTACGCTTGTGCCAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011192.3-272s21c1
Sequence:CCGGGCAGAAGACTTGGTGGCAAATCTCGAGATTTGCCACCAAGTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011192.3-752s21c1
Sequence:CCGGAGAGCCAAATTGGTTTCTAAACTCGAGTTTAGAAACCAATTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011192.3-806s21c1
Sequence:CCGGCGCACTGTCACAGAGATTGATCTCGAGATCAATCTCTGTGACAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011192
VALIDATED
PSME3 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011192.2-586s1c1
Sequence:CCGGCGAGAAATGTAACACGGTCAACTCGAGTTGACCGTGTTACATTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011192.2-299s1c1
Sequence:CCGGCCAAAGAAGTTACTAGAACTTCTCGAGAAGTTCTAGTAACTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011192.2-806s1c1
Sequence:CCGGCGCACTGTCACAGAGATTGATCTCGAGATCAATCTCTGTGACAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011192.2-272s1c1
Sequence:CCGGGCAGAAGACTTGGTGGCAAATCTCGAGATTTGCCACCAAGTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011192.2-752s1c1
Sequence:CCGGAGAGCCAAATTGGTTTCTAAACTCGAGTTTAGAAACCAATTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011192.3-1224s21c1
Sequence:CCGGCATACTGGCACAAGCGTAATTCTCGAGAATTACGCTTGTGCCAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011192.3-272s21c1
Sequence:CCGGGCAGAAGACTTGGTGGCAAATCTCGAGATTTGCCACCAAGTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011192.3-752s21c1
Sequence:CCGGAGAGCCAAATTGGTTTCTAAACTCGAGTTTAGAAACCAATTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011192.3-806s21c1
Sequence:CCGGCGCACTGTCACAGAGATTGATCTCGAGATCAATCTCTGTGACAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011192
VALIDATED
PSME3 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011192.2-586s1c1
Sequence:CCGGCGAGAAATGTAACACGGTCAACTCGAGTTGACCGTGTTACATTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011192.2-299s1c1
Sequence:CCGGCCAAAGAAGTTACTAGAACTTCTCGAGAAGTTCTAGTAACTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011192.2-806s1c1
Sequence:CCGGCGCACTGTCACAGAGATTGATCTCGAGATCAATCTCTGTGACAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011192.2-272s1c1
Sequence:CCGGGCAGAAGACTTGGTGGCAAATCTCGAGATTTGCCACCAAGTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011192.2-752s1c1
Sequence:CCGGAGAGCCAAATTGGTTTCTAAACTCGAGTTTAGAAACCAATTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011192.3-1224s21c1
Sequence:CCGGCATACTGGCACAAGCGTAATTCTCGAGAATTACGCTTGTGCCAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011192.3-272s21c1
Sequence:CCGGGCAGAAGACTTGGTGGCAAATCTCGAGATTTGCCACCAAGTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011192.3-752s21c1
Sequence:CCGGAGAGCCAAATTGGTTTCTAAACTCGAGTTTAGAAACCAATTTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011192.3-806s21c1
Sequence:CCGGCGCACTGTCACAGAGATTGATCTCGAGATCAATCTCTGTGACAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks