EMAIL THIS PAGE TO A FRIEND

PSMG1

proteasome (prosome, macropain) assembly chaperone 1

Synonyms: C21LRP DSCR2 LRPC21 PAC-1 PAC1
UniProtKB ID: O95456, B5BUN2, Q6FHA3, Q6FHD3, Q6S713
Gene ID:
Mouse(56088) proteasome (prosome, macropain) assembly chaperone 1
Rat(288236) proteasome (prosome, macropain) assembly chaperone 1
domestic guinea pig(100725816) proteasome (prosome, macropain) assembly chaperone 1
naked mole-rat(101715056) proteasome (prosome, macropain) assembly chaperone 1
Domestic Rabbit(100328650) proteasome (prosome, macropain) assembly chaperone 1
cow(614817) proteasome (prosome, macropain) assembly chaperone 1
sheep(101117642) proteasome (prosome, macropain) assembly chaperone 1
Zebrafish(436987) proteasome (prosome, macropain) assembly chaperone 1
chicken(418520) proteasome (prosome, macropain) assembly chaperone 1
domestic cat(101080317) proteasome (prosome, macropain) assembly chaperone 1
dog(608101) proteasome (prosome, macropain) assembly chaperone 1
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019537 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019537 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019537 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003720 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003720 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003720 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003720 Rosetta Predictions human pricing
NM_203433 Rosetta Predictions human pricing
NM_001105891 Rosetta Predictions rat pricing
NM_019537 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075782 predicted 837
2 SASI_Hs02_00336148 predicted 829
3 SASI_Hs01_00075784 predicted 879
4 SASI_Hs01_00075785 predicted 848
5 SASI_Hs01_00075786 predicted 852
6 SASI_Hs02_00336149 predicted 849
7 SASI_Hs01_00075788 predicted 846
8 SASI_Hs01_00075789 predicted 892
9 SASI_Hs02_00336150 predicted 786
10 SASI_Hs02_00336151 predicted 873
11 SASI_Hs01_00075783 predicted 814
12 SASI_Hs01_00075787 predicted 881
13 SASI_Hs01_00075790 predicted 811
14 SASI_Hs01_00075791 predicted 817
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087140 predicted 778
2 SASI_Hs02_00373355 predicted 767
3 SASI_Hs01_00087142 predicted 814
4 SASI_Hs01_00087143 predicted 783
5 SASI_Hs01_00087144 predicted 788
6 SASI_Hs01_00087145 predicted 818
7 SASI_Hs02_00373356 predicted 792
8 SASI_Hs01_00087146 predicted 792
9 SASI_Hs01_00087147 predicted 831
10 SASI_Hs02_00373357 predicted 817
11 SASI_Hs01_00087141 predicted 756
12 SASI_Hs01_00087148 predicted 754
13 SASI_Hs01_00087149 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105891 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213552 predicted 791
2 SASI_Rn02_00213553 predicted 890
3 SASI_Rn02_00213554 predicted 857
4 SASI_Rn02_00213555 predicted 470
5 SASI_Rn02_00213556 predicted 541
6 SASI_Rn02_00213557 predicted 779
7 SASI_Rn02_00213558 predicted 683
8 SASI_Rn02_00213559 predicted 671
9 SASI_Rn02_00213560 predicted 871
10 SASI_Rn02_00213561 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019537 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110488 predicted 515
2 SASI_Mm02_00324567 predicted 738
3 SASI_Mm02_00324568 predicted 706
4 SASI_Mm01_00110490 predicted 628
5 SASI_Mm01_00110492 predicted 672
6 SASI_Mm01_00110493 predicted 258
7 SASI_Mm02_00324569 predicted 571
8 SASI_Mm01_00110495 predicted 695
9 SASI_Mm02_00324570 predicted 206
10 SASI_Mm01_00110497 predicted 522
11 SASI_Mm01_00110489 predicted 580
12 SASI_Mm01_00110491 predicted 307
13 SASI_Mm01_00110494 predicted 197
14 SASI_Mm01_00110496 predicted 500
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019537
VALIDATED
PSMG1 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) assembly chaperone 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019537.2-163s21c1
Sequence:CCGGTCTCCGAAGACAGACAGAAACCTCGAGGTTTCTGTCTGTCTTCGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019537.2-843s21c1
Sequence:CCGGTGATGACCACAAATGAGATTCCTCGAGGAATCTCATTTGTGGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019537.2-574s21c1
Sequence:CCGGTCCTTTCCTGAGAGCCCTAAACTCGAGTTTAGGGCTCTCAGGAAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019537.2-211s21c1
Sequence:CCGGACACCCTTGCTCCAAGTTTATCTCGAGATAAACTTGGAGCAAGGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019537.2-740s21c1
Sequence:CCGGTTGGACCGTGTCACGGTTGAACTCGAGTTCAACCGTGACACGGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019537.2-420s21c1
Sequence:CCGGGTCAGTGTAGCTGCTACATTGCTCGAGCAATGTAGCAGCTACACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019537.1-707s1c1
Sequence:CCGGCGGTTCTGTATCTGTGCTACACTCGAGTGTAGCACAGATACAGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019537.1-271s1c1
Sequence:CCGGGCGTTTGTTATGAACTCGGGACTCGAGTCCCGAGTTCATAACAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019537.1-637s1c1
Sequence:CCGGGAACAGCCGAACATTGTGCATCTCGAGATGCACAATGTTCGGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019537.1-259s1c1
Sequence:CCGGGCATTCCTGTCAGCGTTTGTTCTCGAGAACAAACGCTGACAGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019537
VALIDATED
PSMG1 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) assembly chaperone 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019537.2-163s21c1
Sequence:CCGGTCTCCGAAGACAGACAGAAACCTCGAGGTTTCTGTCTGTCTTCGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019537.2-843s21c1
Sequence:CCGGTGATGACCACAAATGAGATTCCTCGAGGAATCTCATTTGTGGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019537.2-574s21c1
Sequence:CCGGTCCTTTCCTGAGAGCCCTAAACTCGAGTTTAGGGCTCTCAGGAAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019537.2-211s21c1
Sequence:CCGGACACCCTTGCTCCAAGTTTATCTCGAGATAAACTTGGAGCAAGGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019537.2-740s21c1
Sequence:CCGGTTGGACCGTGTCACGGTTGAACTCGAGTTCAACCGTGACACGGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019537.2-420s21c1
Sequence:CCGGGTCAGTGTAGCTGCTACATTGCTCGAGCAATGTAGCAGCTACACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019537.1-707s1c1
Sequence:CCGGCGGTTCTGTATCTGTGCTACACTCGAGTGTAGCACAGATACAGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019537.1-271s1c1
Sequence:CCGGGCGTTTGTTATGAACTCGGGACTCGAGTCCCGAGTTCATAACAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019537.1-637s1c1
Sequence:CCGGGAACAGCCGAACATTGTGCATCTCGAGATGCACAATGTTCGGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019537.1-259s1c1
Sequence:CCGGGCATTCCTGTCAGCGTTTGTTCTCGAGAACAAACGCTGACAGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019537
VALIDATED
PSMG1 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) assembly chaperone 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019537.2-163s21c1
Sequence:CCGGTCTCCGAAGACAGACAGAAACCTCGAGGTTTCTGTCTGTCTTCGGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019537.2-843s21c1
Sequence:CCGGTGATGACCACAAATGAGATTCCTCGAGGAATCTCATTTGTGGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019537.2-574s21c1
Sequence:CCGGTCCTTTCCTGAGAGCCCTAAACTCGAGTTTAGGGCTCTCAGGAAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019537.2-211s21c1
Sequence:CCGGACACCCTTGCTCCAAGTTTATCTCGAGATAAACTTGGAGCAAGGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019537.2-740s21c1
Sequence:CCGGTTGGACCGTGTCACGGTTGAACTCGAGTTCAACCGTGACACGGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019537.2-420s21c1
Sequence:CCGGGTCAGTGTAGCTGCTACATTGCTCGAGCAATGTAGCAGCTACACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019537.1-707s1c1
Sequence:CCGGCGGTTCTGTATCTGTGCTACACTCGAGTGTAGCACAGATACAGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019537.1-271s1c1
Sequence:CCGGGCGTTTGTTATGAACTCGGGACTCGAGTCCCGAGTTCATAACAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019537.1-637s1c1
Sequence:CCGGGAACAGCCGAACATTGTGCATCTCGAGATGCACAATGTTCGGCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019537.1-259s1c1
Sequence:CCGGGCATTCCTGTCAGCGTTTGTTCTCGAGAACAAACGCTGACAGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003720
VALIDATED
PSMG1 MISSION shRNA Bacterial Glycerol Stock
proteasome (prosome, macropain) assembly chaperone 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003720.2-328s21c1
Sequence:CCGGCCGTGCTCCAAGTTTATAATTCTCGAGAATTATAAACTTGGAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003720.2-635s21c1
Sequence:CCGGGTCGACATGTTACCGATTATACTCGAGTATAATCGGTAACATGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003720.2-817s21c1
Sequence:CCGGGCAATTCTGTACTTGTGTTATCTCGAGATAACACAAGTACAGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003720.2-935s21c1
Sequence:CCGGGCACTGAGATACTAAAGAAATCTCGAGATTTCTTTAGTATCTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003720.2-754s21c1
Sequence:CCGGCCGAATATAGTACACGACCTTCTCGAGAAGGTCGTGTACTATATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003720.2-935s1c1
Sequence:CCGGGCACTGAGATACTAAAGAAATCTCGAGATTTCTTTAGTATCTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003720.2-328s1c1
Sequence:CCGGCCGTGCTCCAAGTTTATAATTCTCGAGAATTATAAACTTGGAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003720.2-635s1c1
Sequence:CCGGGTCGACATGTTACCGATTATACTCGAGTATAATCGGTAACATGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003720.2-754s1c1
Sequence:CCGGCCGAATATAGTACACGACCTTCTCGAGAAGGTCGTGTACTATATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003720.2-817s1c1
Sequence:CCGGGCAATTCTGTACTTGTGTTATCTCGAGATAACACAAGTACAGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003720
VALIDATED
PSMG1 MISSION shRNA shRNA Plasmid DNA
proteasome (prosome, macropain) assembly chaperone 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003720.2-328s21c1
Sequence:CCGGCCGTGCTCCAAGTTTATAATTCTCGAGAATTATAAACTTGGAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003720.2-635s21c1
Sequence:CCGGGTCGACATGTTACCGATTATACTCGAGTATAATCGGTAACATGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003720.2-817s21c1
Sequence:CCGGGCAATTCTGTACTTGTGTTATCTCGAGATAACACAAGTACAGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003720.2-935s21c1
Sequence:CCGGGCACTGAGATACTAAAGAAATCTCGAGATTTCTTTAGTATCTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003720.2-754s21c1
Sequence:CCGGCCGAATATAGTACACGACCTTCTCGAGAAGGTCGTGTACTATATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003720.2-935s1c1
Sequence:CCGGGCACTGAGATACTAAAGAAATCTCGAGATTTCTTTAGTATCTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003720.2-328s1c1
Sequence:CCGGCCGTGCTCCAAGTTTATAATTCTCGAGAATTATAAACTTGGAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003720.2-635s1c1
Sequence:CCGGGTCGACATGTTACCGATTATACTCGAGTATAATCGGTAACATGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003720.2-754s1c1
Sequence:CCGGCCGAATATAGTACACGACCTTCTCGAGAAGGTCGTGTACTATATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003720.2-817s1c1
Sequence:CCGGGCAATTCTGTACTTGTGTTATCTCGAGATAACACAAGTACAGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003720
VALIDATED
PSMG1 MISSION shRNA Lentiviral Transduction Particles
proteasome (prosome, macropain) assembly chaperone 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003720.2-328s21c1
Sequence:CCGGCCGTGCTCCAAGTTTATAATTCTCGAGAATTATAAACTTGGAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003720.2-635s21c1
Sequence:CCGGGTCGACATGTTACCGATTATACTCGAGTATAATCGGTAACATGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003720.2-817s21c1
Sequence:CCGGGCAATTCTGTACTTGTGTTATCTCGAGATAACACAAGTACAGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003720.2-935s21c1
Sequence:CCGGGCACTGAGATACTAAAGAAATCTCGAGATTTCTTTAGTATCTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003720.2-754s21c1
Sequence:CCGGCCGAATATAGTACACGACCTTCTCGAGAAGGTCGTGTACTATATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003720.2-935s1c1
Sequence:CCGGGCACTGAGATACTAAAGAAATCTCGAGATTTCTTTAGTATCTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003720.2-328s1c1
Sequence:CCGGCCGTGCTCCAAGTTTATAATTCTCGAGAATTATAAACTTGGAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003720.2-635s1c1
Sequence:CCGGGTCGACATGTTACCGATTATACTCGAGTATAATCGGTAACATGTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_003720.2-754s1c1
Sequence:CCGGCCGAATATAGTACACGACCTTCTCGAGAAGGTCGTGTACTATATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003720.2-817s1c1
Sequence:CCGGGCAATTCTGTACTTGTGTTATCTCGAGATAACACAAGTACAGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks