EMAIL THIS PAGE TO A FRIEND

PSPN

persephin

Synonyms: PSP
UniProtKB ID: O60542
Gene ID:
Human(5623) Summary: The protein encoded by this gene is a neurotrophic factor, belonging to the GDNF family. Neurotrophic factors are important for the proper development and maintenance of the nervous system. These factors promote neuronal survival and can prevent the neuronal degeneration associated with injury, toxin exposure, or neurodegenerative disease. The encoded protein has amino acid similarity to its other family members, glial cell line-derived neurotrophic factor and neurturin. This gene product promotes the survival of ventral midbrain dopaminergic neurons in culture and prevents their degeneration after 6-hydroxydopamine treatment in vivo. [provided by RefSeq, Jul 2008]
Mouse(19197) persephin
Rat(25525) persephin
dog(611734) persephin
cow(518266) persephin
sheep(101109705) persephin
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301176 Anti-PSPN antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008954 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008954 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008954 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004158 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004158 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004158 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU003371 MISSION® esiRNA esiRNA targeting mouse Pspn (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004158 Rosetta Predictions human pricing
NM_013014 Rosetta Predictions rat pricing
NM_008954 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004158 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226979 predicted 231
2 SASI_Hs01_00226980 predicted 201
3 SASI_Hs01_00226981 predicted 234
4 SASI_Hs01_00226982 predicted 232
5 SASI_Hs01_00226983 predicted 230
6 SASI_Hs01_00226985 predicted 181
7 SASI_Hs01_00226986 predicted 91
8 SASI_Hs01_00226987 predicted 381
9 SASI_Hs01_00226988 predicted 167
10 SASI_Hs02_00337015 predicted 173
11 SASI_Hs01_00226984 predicted 115
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013014 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117048 predicted 208
2 SASI_Rn01_00117050 predicted 245
3 SASI_Rn01_00117051 predicted 243
4 SASI_Rn01_00117052 predicted 237
5 SASI_Rn01_00117053 predicted 247
6 SASI_Rn01_00117054 predicted 197
7 SASI_Rn02_00260673 predicted 93
8 SASI_Rn02_00260674 predicted 374
9 SASI_Rn02_00260675 predicted 10
10 SASI_Rn02_00260676 predicted 388
11 SASI_Rn01_00117049 predicted 232
12 SASI_Rn01_00117055 predicted 212
13 SASI_Rn01_00117056 predicted 248
14 SASI_Rn01_00117057 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008954 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088803 predicted 240
2 SASI_Mm01_00088804 predicted 208
3 SASI_Mm01_00088805 predicted 245
4 SASI_Mm01_00088806 predicted 236
5 SASI_Mm01_00088807 predicted 244
6 SASI_Mm02_00315020 predicted 12
7 SASI_Mm01_00088809 predicted 155
8 SASI_Mm01_00088810 predicted 181
9 SASI_Mm01_00088811 predicted 90
10 SASI_Mm01_00088812 predicted 379
11 SASI_Mm01_00088808 predicted 81
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008954
PSPN MISSION shRNA Bacterial Glycerol Stock
persephin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008954.1-155s1c1
Sequence:CCGGGTAACAACCATGTCCGTCTTCCTCGAGGAAGACGGACATGGTTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008954.1-97s1c1
Sequence:CCGGGATAAGCTCTCATTTGGGAAGCTCGAGCTTCCCAAATGAGAGCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008954.1-147s1c1
Sequence:CCGGCCATCAGGGTAACAACCATGTCTCGAGACATGGTTGTTACCCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008954.1-89s1c1
Sequence:CCGGCTGTGGCAGATAAGCTCTCATCTCGAGATGAGAGCTTATCTGCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008954.1-256s1c1
Sequence:CCGGGAGAAGGTCATCTTCCGATACCTCGAGGTATCGGAAGATGACCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008954
PSPN MISSION shRNA shRNA Plasmid DNA
persephin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008954.1-155s1c1
Sequence:CCGGGTAACAACCATGTCCGTCTTCCTCGAGGAAGACGGACATGGTTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008954.1-97s1c1
Sequence:CCGGGATAAGCTCTCATTTGGGAAGCTCGAGCTTCCCAAATGAGAGCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008954.1-147s1c1
Sequence:CCGGCCATCAGGGTAACAACCATGTCTCGAGACATGGTTGTTACCCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008954.1-89s1c1
Sequence:CCGGCTGTGGCAGATAAGCTCTCATCTCGAGATGAGAGCTTATCTGCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008954.1-256s1c1
Sequence:CCGGGAGAAGGTCATCTTCCGATACCTCGAGGTATCGGAAGATGACCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008954
PSPN MISSION shRNA Lentiviral Transduction Particles
persephin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008954.1-155s1c1
Sequence:CCGGGTAACAACCATGTCCGTCTTCCTCGAGGAAGACGGACATGGTTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008954.1-97s1c1
Sequence:CCGGGATAAGCTCTCATTTGGGAAGCTCGAGCTTCCCAAATGAGAGCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008954.1-147s1c1
Sequence:CCGGCCATCAGGGTAACAACCATGTCTCGAGACATGGTTGTTACCCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008954.1-89s1c1
Sequence:CCGGCTGTGGCAGATAAGCTCTCATCTCGAGATGAGAGCTTATCTGCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008954.1-256s1c1
Sequence:CCGGGAGAAGGTCATCTTCCGATACCTCGAGGTATCGGAAGATGACCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004158
PSPN MISSION shRNA Bacterial Glycerol Stock
persephin
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004158.2-249s21c1
Sequence:CCGGCTCAGAGGAGAAGGTCATCTTCTCGAGAAGATGACCTTCTCCTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004158.2-109s21c1
Sequence:CCGGTCGTCTGAACAGGTGGCAAAGCTCGAGCTTTGCCACCTGTTCAGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004158.2-260s21c1
Sequence:CCGGAGGTCATCTTCCGCTACTGCGCTCGAGCGCAGTAGCGGAAGATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004158.2-185s21c1
Sequence:CCGGTGTCTGGTCCATGCCAGCTGTCTCGAGACAGCTGGCATGGACCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004158.2-97s21c1
Sequence:CCGGGATGGAGAGTTCTCGTCTGAACTCGAGTTCAGACGAGAACTCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004158
PSPN MISSION shRNA shRNA Plasmid DNA
persephin
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004158.2-249s21c1
Sequence:CCGGCTCAGAGGAGAAGGTCATCTTCTCGAGAAGATGACCTTCTCCTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004158.2-109s21c1
Sequence:CCGGTCGTCTGAACAGGTGGCAAAGCTCGAGCTTTGCCACCTGTTCAGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004158.2-260s21c1
Sequence:CCGGAGGTCATCTTCCGCTACTGCGCTCGAGCGCAGTAGCGGAAGATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004158.2-185s21c1
Sequence:CCGGTGTCTGGTCCATGCCAGCTGTCTCGAGACAGCTGGCATGGACCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004158.2-97s21c1
Sequence:CCGGGATGGAGAGTTCTCGTCTGAACTCGAGTTCAGACGAGAACTCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004158
PSPN MISSION shRNA Lentiviral Transduction Particles
persephin
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004158.2-249s21c1
Sequence:CCGGCTCAGAGGAGAAGGTCATCTTCTCGAGAAGATGACCTTCTCCTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004158.2-109s21c1
Sequence:CCGGTCGTCTGAACAGGTGGCAAAGCTCGAGCTTTGCCACCTGTTCAGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004158.2-260s21c1
Sequence:CCGGAGGTCATCTTCCGCTACTGCGCTCGAGCGCAGTAGCGGAAGATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004158.2-185s21c1
Sequence:CCGGTGTCTGGTCCATGCCAGCTGTCTCGAGACAGCTGGCATGGACCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004158.2-97s21c1
Sequence:CCGGGATGGAGAGTTCTCGTCTGAACTCGAGTTCAGACGAGAACTCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks