EMAIL THIS PAGE TO A FRIEND

PSTK

phosphoseryl-tRNA kinase

Synonyms: C10orf89
UniProtKB ID: Q8IV42, Q6ZSS9
Gene ID:
Mouse(214580) phosphoseryl-tRNA kinase
cow(511744) phosphoseryl-tRNA kinase
sheep(101113029) phosphoseryl-tRNA kinase
naked mole-rat(101700708) phosphoseryl-tRNA kinase
domestic guinea pig(100715100) phosphoseryl-tRNA kinase
chicken(771778) phosphoseryl-tRNA kinase
dog(477855) phosphoseryl-tRNA kinase
domestic cat(101097176) phosphoseryl-tRNA kinase
37 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177609 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177609 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177609 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153336 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153336 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153336 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039534 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039534 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039534 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153336 Rosetta Predictions human pricing
NM_001039534 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153336 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062432 predicted 787
2 SASI_Hs01_00062433 predicted 670
3 SASI_Hs01_00062434 predicted 685
4 SASI_Hs01_00062435 predicted 658
5 SASI_Hs01_00062436 predicted 795
6 SASI_Hs01_00062437 predicted 700
7 SASI_Hs01_00062438 predicted 602
8 SASI_Hs01_00062439 predicted 583
9 SASI_Hs01_00062440 predicted 748
10 SASI_Hs01_00062441 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039534 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066237 predicted 532
2 SASI_Mm01_00066238 predicted 756
3 SASI_Mm01_00066239 predicted 888
4 SASI_Mm01_00066240 predicted 522
5 SASI_Mm01_00066241 predicted 293
6 SASI_Mm01_00066242 predicted 531
7 SASI_Mm01_00066243 predicted 903
8 SASI_Mm01_00066244 predicted 274
9 SASI_Mm01_00066245 predicted 511
10 SASI_Mm02_00290123 predicted 749
11 SASI_Mm01_00066246 predicted 341
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177609
PSTK MISSION shRNA Bacterial Glycerol Stock
phosphoseryl-tRNA kinase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177609.2-910s1c1
Sequence:CCGGCCTCTTAATAACTTGAAGCATCTCGAGATGCTTCAAGTTATTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177609.2-534s1c1
Sequence:CCGGCGGAAATATTCGCTAGGCTTTCTCGAGAAAGCCTAGCGAATATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177609.2-263s1c1
Sequence:CCGGGTTCCGACAAGAACTGTTAAACTCGAGTTTAACAGTTCTTGTCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177609.2-365s1c1
Sequence:CCGGAGACTTCATAACCTGCTTAAACTCGAGTTTAAGCAGGTTATGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177609.2-262s1c1
Sequence:CCGGTGTTCCGACAAGAACTGTTAACTCGAGTTAACAGTTCTTGTCGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177609
PSTK MISSION shRNA shRNA Plasmid DNA
phosphoseryl-tRNA kinase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177609.2-910s1c1
Sequence:CCGGCCTCTTAATAACTTGAAGCATCTCGAGATGCTTCAAGTTATTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177609.2-534s1c1
Sequence:CCGGCGGAAATATTCGCTAGGCTTTCTCGAGAAAGCCTAGCGAATATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177609.2-263s1c1
Sequence:CCGGGTTCCGACAAGAACTGTTAAACTCGAGTTTAACAGTTCTTGTCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177609.2-365s1c1
Sequence:CCGGAGACTTCATAACCTGCTTAAACTCGAGTTTAAGCAGGTTATGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177609.2-262s1c1
Sequence:CCGGTGTTCCGACAAGAACTGTTAACTCGAGTTAACAGTTCTTGTCGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177609
PSTK MISSION shRNA Lentiviral Transduction Particles
phosphoseryl-tRNA kinase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177609.2-910s1c1
Sequence:CCGGCCTCTTAATAACTTGAAGCATCTCGAGATGCTTCAAGTTATTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177609.2-534s1c1
Sequence:CCGGCGGAAATATTCGCTAGGCTTTCTCGAGAAAGCCTAGCGAATATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177609.2-263s1c1
Sequence:CCGGGTTCCGACAAGAACTGTTAAACTCGAGTTTAACAGTTCTTGTCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177609.2-365s1c1
Sequence:CCGGAGACTTCATAACCTGCTTAAACTCGAGTTTAAGCAGGTTATGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177609.2-262s1c1
Sequence:CCGGTGTTCCGACAAGAACTGTTAACTCGAGTTAACAGTTCTTGTCGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153336
VALIDATED
PSTK MISSION shRNA Bacterial Glycerol Stock
phosphoseryl-tRNA kinase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153336.1-1503s1c1
Sequence:CCGGCCTCACAACTTGAAGCTTCTACTCGAGTAGAAGCTTCAAGTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153336.1-1329s1c1
Sequence:CCGGGCCTTCTCAGAGATGACATTTCTCGAGAAATGTCATCTCTGAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153336.1-657s1c1
Sequence:CCGGCCATCCCAATGGAAATTGCTTCTCGAGAAGCAATTTCCATTGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153336.1-684s1c1
Sequence:CCGGGAACTGTTGAAGTACCTGGAACTCGAGTTCCAGGTACTTCAACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_153336.1-1282s1c1
Sequence:CCGGGAAGGATTGTATCTCAGACAACTCGAGTTGTCTGAGATACAATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153336.1-1518s21c1
Sequence:CCGGCTTCTAGCAGAAGAACTTAACCTCGAGGTTAAGTTCTTCTGCTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153336.1-1378s21c1
Sequence:CCGGCAGCTATCTGGAGGATCATTCCTCGAGGAATGATCCTCCAGATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153336.1-1044s21c1
Sequence:CCGGATCCACCTGATGCGAAGAAAGCTCGAGCTTTCTTCGCATCAGGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153336.1-930s21c1
Sequence:CCGGTACCAGCTGGCTCGGAAATATCTCGAGATATTTCCGAGCCAGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153336.1-708s21c1
Sequence:CCGGTTCTTGATGGCTGTCATTAATCTCGAGATTAATGACAGCCATCAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153336
VALIDATED
PSTK MISSION shRNA shRNA Plasmid DNA
phosphoseryl-tRNA kinase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153336.1-1503s1c1
Sequence:CCGGCCTCACAACTTGAAGCTTCTACTCGAGTAGAAGCTTCAAGTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153336.1-1329s1c1
Sequence:CCGGGCCTTCTCAGAGATGACATTTCTCGAGAAATGTCATCTCTGAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153336.1-657s1c1
Sequence:CCGGCCATCCCAATGGAAATTGCTTCTCGAGAAGCAATTTCCATTGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153336.1-684s1c1
Sequence:CCGGGAACTGTTGAAGTACCTGGAACTCGAGTTCCAGGTACTTCAACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_153336.1-1282s1c1
Sequence:CCGGGAAGGATTGTATCTCAGACAACTCGAGTTGTCTGAGATACAATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153336.1-1518s21c1
Sequence:CCGGCTTCTAGCAGAAGAACTTAACCTCGAGGTTAAGTTCTTCTGCTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153336.1-1378s21c1
Sequence:CCGGCAGCTATCTGGAGGATCATTCCTCGAGGAATGATCCTCCAGATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153336.1-1044s21c1
Sequence:CCGGATCCACCTGATGCGAAGAAAGCTCGAGCTTTCTTCGCATCAGGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153336.1-930s21c1
Sequence:CCGGTACCAGCTGGCTCGGAAATATCTCGAGATATTTCCGAGCCAGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153336.1-708s21c1
Sequence:CCGGTTCTTGATGGCTGTCATTAATCTCGAGATTAATGACAGCCATCAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153336
VALIDATED
PSTK MISSION shRNA Lentiviral Transduction Particles
phosphoseryl-tRNA kinase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149427    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153336.1-1503s1c1
Sequence:CCGGCCTCACAACTTGAAGCTTCTACTCGAGTAGAAGCTTCAAGTTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153336.1-1329s1c1
Sequence:CCGGGCCTTCTCAGAGATGACATTTCTCGAGAAATGTCATCTCTGAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153336.1-657s1c1
Sequence:CCGGCCATCCCAATGGAAATTGCTTCTCGAGAAGCAATTTCCATTGGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153336.1-684s1c1
Sequence:CCGGGAACTGTTGAAGTACCTGGAACTCGAGTTCCAGGTACTTCAACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_153336.1-1282s1c1
Sequence:CCGGGAAGGATTGTATCTCAGACAACTCGAGTTGTCTGAGATACAATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153336.1-1518s21c1
Sequence:CCGGCTTCTAGCAGAAGAACTTAACCTCGAGGTTAAGTTCTTCTGCTAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153336.1-1378s21c1
Sequence:CCGGCAGCTATCTGGAGGATCATTCCTCGAGGAATGATCCTCCAGATAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153336.1-1044s21c1
Sequence:CCGGATCCACCTGATGCGAAGAAAGCTCGAGCTTTCTTCGCATCAGGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153336.1-930s21c1
Sequence:CCGGTACCAGCTGGCTCGGAAATATCTCGAGATATTTCCGAGCCAGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153336.1-708s21c1
Sequence:CCGGTTCTTGATGGCTGTCATTAATCTCGAGATTAATGACAGCCATCAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039534
PSTK MISSION shRNA Bacterial Glycerol Stock
phosphoseryl-tRNA kinase
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039534.1-387s21c1
Sequence:CCGGGTCAGGATTTGATGATCTTTCCTCGAGGAAAGATCATCAAATCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039534.1-495s21c1
Sequence:CCGGATTACCAAAGTATGAGATATGCTCGAGCATATCTCATACTTTGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039534.1-752s21c1
Sequence:CCGGGGTTTGTTGCTTACTGCATTGCTCGAGCAATGCAGTAAGCAACAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039534.1-858s21c1
Sequence:CCGGCTGATGAGACACTCCGAAGAACTCGAGTTCTTCGGAGTGTCTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039534.1-521s21c1
Sequence:CCGGTACCAACTGGCTCGGAAATATCTCGAGATATTTCCGAGCCAGTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039534.1-824s21c1
Sequence:CCGGAGAATTATCTGTTCTACTAACCTCGAGGTTAGTAGAACAGATAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039534.1-689s21c1
Sequence:CCGGGAACACAACAGCCTCATAATTCTCGAGAATTATGAGGCTGTTGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039534
PSTK MISSION shRNA shRNA Plasmid DNA
phosphoseryl-tRNA kinase
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039534.1-387s21c1
Sequence:CCGGGTCAGGATTTGATGATCTTTCCTCGAGGAAAGATCATCAAATCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039534.1-495s21c1
Sequence:CCGGATTACCAAAGTATGAGATATGCTCGAGCATATCTCATACTTTGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039534.1-752s21c1
Sequence:CCGGGGTTTGTTGCTTACTGCATTGCTCGAGCAATGCAGTAAGCAACAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039534.1-858s21c1
Sequence:CCGGCTGATGAGACACTCCGAAGAACTCGAGTTCTTCGGAGTGTCTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039534.1-521s21c1
Sequence:CCGGTACCAACTGGCTCGGAAATATCTCGAGATATTTCCGAGCCAGTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039534.1-824s21c1
Sequence:CCGGAGAATTATCTGTTCTACTAACCTCGAGGTTAGTAGAACAGATAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039534.1-689s21c1
Sequence:CCGGGAACACAACAGCCTCATAATTCTCGAGAATTATGAGGCTGTTGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039534
PSTK MISSION shRNA Lentiviral Transduction Particles
phosphoseryl-tRNA kinase
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039534.1-387s21c1
Sequence:CCGGGTCAGGATTTGATGATCTTTCCTCGAGGAAAGATCATCAAATCCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039534.1-495s21c1
Sequence:CCGGATTACCAAAGTATGAGATATGCTCGAGCATATCTCATACTTTGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039534.1-752s21c1
Sequence:CCGGGGTTTGTTGCTTACTGCATTGCTCGAGCAATGCAGTAAGCAACAAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039534.1-858s21c1
Sequence:CCGGCTGATGAGACACTCCGAAGAACTCGAGTTCTTCGGAGTGTCTCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039534.1-521s21c1
Sequence:CCGGTACCAACTGGCTCGGAAATATCTCGAGATATTTCCGAGCCAGTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039534.1-824s21c1
Sequence:CCGGAGAATTATCTGTTCTACTAACCTCGAGGTTAGTAGAACAGATAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039534.1-689s21c1
Sequence:CCGGGAACACAACAGCCTCATAATTCTCGAGAATTATGAGGCTGTTGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks