EMAIL THIS PAGE TO A FRIEND

PSTPIP1

proline-serine-threonine phosphatase interacting protein 1

Synonyms: CD2BP1 CD2BP1L CD2BP1S H-PIP PAPAS PSTPIP
UniProtKB ID: O43586, B5BU74, B5BUK4, O43585, O95657
Gene ID:
Human(9051) Summary: The protein encoded by this gene binds to the cytoplasmic tail of CD2, an effector of T cell activation and adhesion, negatively affecting CD2-triggered T cell activation. The encoded protein appears to be a scaffold protein and a regulator of the actin cytoskeleton. It has also been shown to bind ABL1, PTPN18, WAS, CD2AP, and PTPN12. Mutations in this gene are a cause of PAPA syndrome. [provided by RefSeq, Jul 2008]
Mouse(19200) proline-serine-threonine phosphatase-interacting protein 1
Rat(300732) proline-serine-threonine phosphatase-interacting protein 1
chicken(415349) proline-serine-threonine phosphatase interacting protein 1
dog(611757) proline-serine-threonine phosphatase interacting protein 1
Horse(100050881) proline-serine-threonine phosphatase interacting protein 1
domestic cat(101100213) proline-serine-threonine phosphatase interacting protein 1
domestic guinea pig(100732350) proline-serine-threonine phosphatase interacting protein 1
naked mole-rat(101723975) proline-serine-threonine phosphatase interacting protein 1
cow(513924) proline-serine-threonine phosphatase interacting protein 1
sheep(101116939) proline-serine-threonine phosphatase interacting protein 1
Gene Class: Cytoskeleton
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003978 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003978 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003978 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011193 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011193 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011193 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003978 Rosetta Predictions human pricing
NM_001106824 Rosetta Predictions rat pricing
NM_011193 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003978 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038293 predicted 1486
2 SASI_Hs01_00038294 predicted 1165
3 SASI_Hs01_00038295 predicted 1108
4 SASI_Hs01_00038296 predicted 1463
5 SASI_Hs01_00038297 predicted 684
6 SASI_Hs01_00038298 predicted 832
7 SASI_Hs01_00038300 predicted 1153
8 SASI_Hs02_00336670 predicted 751
9 SASI_Hs01_00038301 predicted 1107
10 SASI_Hs01_00038302 predicted 1013
11 SASI_Hs01_00038299 predicted 864
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106824 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222768 predicted 371
2 SASI_Rn02_00222769 predicted 912
3 SASI_Rn02_00222770 predicted 802
4 SASI_Rn02_00222771 predicted 1242
5 SASI_Rn02_00222772 predicted 1224
6 SASI_Rn02_00222773 predicted 321
7 SASI_Rn02_00222774 predicted 1286
8 SASI_Rn02_00222775 predicted 807
9 SASI_Rn02_00222776 predicted 655
10 SASI_Rn02_00222777 predicted 919
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011193 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151131 predicted 1146
2 SASI_Mm01_00151133 predicted 986
3 SASI_Mm01_00151134 predicted 775
4 SASI_Mm01_00151135 predicted 769
5 SASI_Mm01_00151136 predicted 640
6 SASI_Mm01_00151137 predicted 1556
7 SASI_Mm02_00320107 predicted 915
8 SASI_Mm01_00151138 predicted 609
9 SASI_Mm02_00320108 predicted 1532
10 SASI_Mm02_00320109 predicted 1618
11 SASI_Mm01_00151129 predicted 1346
12 SASI_Mm01_00151130 predicted 1342
13 SASI_Mm01_00151132 predicted 1168
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003978
PSTPIP1 MISSION shRNA Bacterial Glycerol Stock
proline-serine-threonine phosphatase interacting protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003978.3-682s21c1
Sequence:CCGGGACTCCTTGAAGCAGCAAATGCTCGAGCATTTGCTGCTTCAAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003978.3-862s21c1
Sequence:CCGGATGGAGTCCAAGAAGACATACCTCGAGGTATGTCTTCTTGGACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003978.3-1292s21c1
Sequence:CCGGCGGTGCCCTACCAGAACTATTCTCGAGAATAGTTCTGGTAGGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003978.3-1233s21c1
Sequence:CCGGAGACGCCGACATCGACAGTTTCTCGAGAAACTGTCGATGTCGGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003978.x-869s1c1
Sequence:CCGGGTGGAGAAGAGTCAGAACAAACTCGAGTTTGTTCTGACTCTTCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003978.x-1156s1c1
Sequence:CCGGCGACAGTTTCATCCAGGCCAACTCGAGTTGGCCTGGATGAAACTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003978.x-1462s1c1
Sequence:CCGGCTACGATTATACAGCGCAGAACTCGAGTTCTGCGCTGTATAATCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003978.x-1747s1c1
Sequence:CCGGTAAAGGAGTGCGTTCTGTTCACTCGAGTGAACAGAACGCACTCCTTTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003978.x-467s1c1
Sequence:CCGGTGCAAAGACATGGAGGAGCTACTCGAGTAGCTCCTCCATGTCTTTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003978
PSTPIP1 MISSION shRNA shRNA Plasmid DNA
proline-serine-threonine phosphatase interacting protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003978.3-682s21c1
Sequence:CCGGGACTCCTTGAAGCAGCAAATGCTCGAGCATTTGCTGCTTCAAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003978.3-862s21c1
Sequence:CCGGATGGAGTCCAAGAAGACATACCTCGAGGTATGTCTTCTTGGACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003978.3-1292s21c1
Sequence:CCGGCGGTGCCCTACCAGAACTATTCTCGAGAATAGTTCTGGTAGGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003978.3-1233s21c1
Sequence:CCGGAGACGCCGACATCGACAGTTTCTCGAGAAACTGTCGATGTCGGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003978.x-869s1c1
Sequence:CCGGGTGGAGAAGAGTCAGAACAAACTCGAGTTTGTTCTGACTCTTCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003978.x-1156s1c1
Sequence:CCGGCGACAGTTTCATCCAGGCCAACTCGAGTTGGCCTGGATGAAACTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003978.x-1462s1c1
Sequence:CCGGCTACGATTATACAGCGCAGAACTCGAGTTCTGCGCTGTATAATCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003978.x-1747s1c1
Sequence:CCGGTAAAGGAGTGCGTTCTGTTCACTCGAGTGAACAGAACGCACTCCTTTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003978.x-467s1c1
Sequence:CCGGTGCAAAGACATGGAGGAGCTACTCGAGTAGCTCCTCCATGTCTTTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003978
PSTPIP1 MISSION shRNA Lentiviral Transduction Particles
proline-serine-threonine phosphatase interacting protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003978.3-682s21c1
Sequence:CCGGGACTCCTTGAAGCAGCAAATGCTCGAGCATTTGCTGCTTCAAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003978.3-862s21c1
Sequence:CCGGATGGAGTCCAAGAAGACATACCTCGAGGTATGTCTTCTTGGACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003978.3-1292s21c1
Sequence:CCGGCGGTGCCCTACCAGAACTATTCTCGAGAATAGTTCTGGTAGGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003978.3-1233s21c1
Sequence:CCGGAGACGCCGACATCGACAGTTTCTCGAGAAACTGTCGATGTCGGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003978.x-869s1c1
Sequence:CCGGGTGGAGAAGAGTCAGAACAAACTCGAGTTTGTTCTGACTCTTCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003978.x-1156s1c1
Sequence:CCGGCGACAGTTTCATCCAGGCCAACTCGAGTTGGCCTGGATGAAACTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003978.x-1462s1c1
Sequence:CCGGCTACGATTATACAGCGCAGAACTCGAGTTCTGCGCTGTATAATCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003978.x-1747s1c1
Sequence:CCGGTAAAGGAGTGCGTTCTGTTCACTCGAGTGAACAGAACGCACTCCTTTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003978.x-467s1c1
Sequence:CCGGTGCAAAGACATGGAGGAGCTACTCGAGTAGCTCCTCCATGTCTTTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011193
PSTPIP1 MISSION shRNA Bacterial Glycerol Stock
proline-serine-threonine phosphatase interacting protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011193.1-1296s1c1
Sequence:CCGGCCCAGGGAAACCTTAACTCATCTCGAGATGAGTTAAGGTTTCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011193.1-1155s1c1
Sequence:CCGGGCGGTGTGATAAAGAGGTTCTCTCGAGAGAACCTCTTTATCACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011193.1-622s1c1
Sequence:CCGGGAAGAGCAAGTTGTCGCTCTACTCGAGTAGAGCGACAACTTGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011193.1-1081s1c1
Sequence:CCGGTCCGGTGCCTTATCAGAACTACTCGAGTAGTTCTGATAAGGCACCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011193.1-1083s1c1
Sequence:CCGGCGGTGCCTTATCAGAACTACTCTCGAGAGTAGTTCTGATAAGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011193
PSTPIP1 MISSION shRNA shRNA Plasmid DNA
proline-serine-threonine phosphatase interacting protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011193.1-1296s1c1
Sequence:CCGGCCCAGGGAAACCTTAACTCATCTCGAGATGAGTTAAGGTTTCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011193.1-1155s1c1
Sequence:CCGGGCGGTGTGATAAAGAGGTTCTCTCGAGAGAACCTCTTTATCACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011193.1-622s1c1
Sequence:CCGGGAAGAGCAAGTTGTCGCTCTACTCGAGTAGAGCGACAACTTGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011193.1-1081s1c1
Sequence:CCGGTCCGGTGCCTTATCAGAACTACTCGAGTAGTTCTGATAAGGCACCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011193.1-1083s1c1
Sequence:CCGGCGGTGCCTTATCAGAACTACTCTCGAGAGTAGTTCTGATAAGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011193
PSTPIP1 MISSION shRNA Lentiviral Transduction Particles
proline-serine-threonine phosphatase interacting protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011193.1-1296s1c1
Sequence:CCGGCCCAGGGAAACCTTAACTCATCTCGAGATGAGTTAAGGTTTCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011193.1-1155s1c1
Sequence:CCGGGCGGTGTGATAAAGAGGTTCTCTCGAGAGAACCTCTTTATCACACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011193.1-622s1c1
Sequence:CCGGGAAGAGCAAGTTGTCGCTCTACTCGAGTAGAGCGACAACTTGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011193.1-1081s1c1
Sequence:CCGGTCCGGTGCCTTATCAGAACTACTCGAGTAGTTCTGATAAGGCACCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011193.1-1083s1c1
Sequence:CCGGCGGTGCCTTATCAGAACTACTCTCGAGAGTAGTTCTGATAAGGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks