EMAIL THIS PAGE TO A FRIEND

PTBP3

polypyrimidine tract binding protein 3

Synonyms: ROD1
Gene ID:
Human(9991) Summary: The protein encoded by this gene binds RNA and is a regulator of cell differentiation. The encoded protein preferentially binds to poly(G) and poly(U) sequences in vitro. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(230257) polypyrimidine tract binding protein 3
Rat(83515) polypyrimidine tract binding protein 3
Zebrafish(798982) polypyrimidine tract binding protein 3
dog(481668) polypyrimidine tract binding protein 3
domestic cat(101101261) polypyrimidine tract binding protein 3
sheep(101111252) polypyrimidine tract binding protein 3
domestic guinea pig(100716967) polypyrimidine tract binding protein 3
naked mole-rat(101713940) polypyrimidine tract binding protein 3
263 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178164 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178164 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178164 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005156 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005156 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005156 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005156 Rosetta Predictions human pricing
NM_031346 Rosetta Predictions rat pricing
NM_144904 Rosetta Predictions mouse pricing
NM_178164 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005156 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133740 predicted 1488
2 SASI_Hs02_00339094 predicted 1734
3 SASI_Hs02_00339095 predicted 1723
4 SASI_Hs01_00133743 predicted 1090
5 SASI_Hs01_00133744 predicted 1214
6 SASI_Hs01_00133745 predicted 389
7 SASI_Hs01_00133746 predicted 979
8 SASI_Hs02_00339096 predicted 1605
9 SASI_Hs01_00133747 predicted 289
10 SASI_Hs01_00133748 predicted 1301
11 SASI_Hs01_00133741 predicted 1437
12 SASI_Hs01_00133742 predicted 1313
13 SASI_Hs01_00133749 predicted 1298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031346 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116939 predicted 1345
2 SASI_Rn01_00116940 predicted 1672
3 SASI_Rn01_00116941 predicted 1635
4 SASI_Rn01_00116942 predicted 686
5 SASI_Rn01_00116943 predicted 337
6 SASI_Rn01_00116944 predicted 923
7 SASI_Rn01_00116945 predicted 733
8 SASI_Rn02_00264581 predicted 1109
9 SASI_Rn01_00116946 predicted 1242
10 SASI_Rn01_00116947 predicted 785
11 SASI_Rn01_00116948 predicted 1244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144904 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074020 predicted 1775
2 SASI_Mm01_00074021 predicted 746
3 SASI_Mm01_00074023 predicted 1322
4 SASI_Mm01_00074024 predicted 694
5 SASI_Mm01_00074025 predicted 1688
6 SASI_Mm01_00074026 predicted 794
7 SASI_Mm02_00340375 predicted 506
8 SASI_Mm01_00074028 predicted 1259
9 SASI_Mm01_00074029 predicted 532
10 SASI_Mm02_00340376 predicted 1007
11 SASI_Mm01_00074022 predicted 1348
12 SASI_Mm01_00074027 predicted 1777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178164 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021202 predicted 1767
2 SASI_Mm01_00021203 predicted 739
3 SASI_Mm01_00021205 predicted 1316
4 SASI_Mm01_00021206 predicted 685
5 SASI_Mm01_00021207 predicted 1674
6 SASI_Mm01_00021208 predicted 783
7 SASI_Mm02_00348606 predicted 485
8 SASI_Mm01_00021210 predicted 1243
9 SASI_Mm01_00021211 predicted 516
10 SASI_Mm02_00348607 predicted 988
11 SASI_Mm01_00021204 predicted 1333
12 SASI_Mm01_00021209 predicted 1770
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178164
VALIDATED
PTBP3 MISSION shRNA Bacterial Glycerol Stock
polypyrimidine tract binding protein 3
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000364024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178164.3-1834s21c1
Sequence:CCGGCATCTGACCTTCCCGTGAAATCTCGAGATTTCACGGGAAGGTCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178164.3-395s21c1
Sequence:CCGGGAAGCAGAGGTCATATCATTACTCGAGTAATGATATGACCTCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178164.2-313s21c1
Sequence:CCGGCACCGAAGCAGAGGTCATATCCTCGAGGATATGACCTCTGCTTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306571    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178164.2-2257s21c1
Sequence:CCGGTACCAGATATTTGCATCTATTCTCGAGAATAGATGCAAATATCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178164.2-344s21c1
Sequence:CCGGCCATTTGGCAAAGTAACTAATCTCGAGATTAGTTACTTTGCCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178164.2-638s21c1
Sequence:CCGGAGCCCTGTGCTCCGGATAATTCTCGAGAATTATCCGGAGCACAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178164.2-419s21c1
Sequence:CCGGGCTGCTGTTACTATGATAAATCTCGAGATTTATCATAGTAACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178164.3-1064s21c1
Sequence:CCGGTTTGGTGCACCGGGTATAATGCTCGAGCATTATACCCGGTGCACCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178164.3-717s21c1
Sequence:CCGGGCCCTGTGCTCCGGATAATTACTCGAGTAATTATCCGGAGCACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178164.1-1770s1c1
Sequence:CCGGCCCGTGAAATTGTCTCCTTATCTCGAGATAAGGAGACAATTTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178164.1-1205s1c1
Sequence:CCGGCCTGACTTTATCACACCACATCTCGAGATGTGGTGTGATAAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178164.1-422s1c1
Sequence:CCGGGCTGCTGTTACTATGATAAATCTCGAGATTTATCATAGTAACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178164.1-1490s1c1
Sequence:CCGGCCCGGCTCAAAGAATTTCCAACTCGAGTTGGAAATTCTTTGAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178164.1-1688s1c1
Sequence:CCGGGCTCTTATTGAGCTTCACAATCTCGAGATTGTGAAGCTCAATAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178164
VALIDATED
PTBP3 MISSION shRNA shRNA Plasmid DNA
polypyrimidine tract binding protein 3
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000364024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178164.3-1834s21c1
Sequence:CCGGCATCTGACCTTCCCGTGAAATCTCGAGATTTCACGGGAAGGTCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178164.3-395s21c1
Sequence:CCGGGAAGCAGAGGTCATATCATTACTCGAGTAATGATATGACCTCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178164.2-313s21c1
Sequence:CCGGCACCGAAGCAGAGGTCATATCCTCGAGGATATGACCTCTGCTTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306571    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178164.2-2257s21c1
Sequence:CCGGTACCAGATATTTGCATCTATTCTCGAGAATAGATGCAAATATCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178164.2-344s21c1
Sequence:CCGGCCATTTGGCAAAGTAACTAATCTCGAGATTAGTTACTTTGCCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178164.2-638s21c1
Sequence:CCGGAGCCCTGTGCTCCGGATAATTCTCGAGAATTATCCGGAGCACAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178164.2-419s21c1
Sequence:CCGGGCTGCTGTTACTATGATAAATCTCGAGATTTATCATAGTAACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178164.3-1064s21c1
Sequence:CCGGTTTGGTGCACCGGGTATAATGCTCGAGCATTATACCCGGTGCACCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178164.3-717s21c1
Sequence:CCGGGCCCTGTGCTCCGGATAATTACTCGAGTAATTATCCGGAGCACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178164.1-1770s1c1
Sequence:CCGGCCCGTGAAATTGTCTCCTTATCTCGAGATAAGGAGACAATTTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178164.1-1205s1c1
Sequence:CCGGCCTGACTTTATCACACCACATCTCGAGATGTGGTGTGATAAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178164.1-422s1c1
Sequence:CCGGGCTGCTGTTACTATGATAAATCTCGAGATTTATCATAGTAACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178164.1-1490s1c1
Sequence:CCGGCCCGGCTCAAAGAATTTCCAACTCGAGTTGGAAATTCTTTGAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178164.1-1688s1c1
Sequence:CCGGGCTCTTATTGAGCTTCACAATCTCGAGATTGTGAAGCTCAATAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178164
VALIDATED
PTBP3 MISSION shRNA Lentiviral Transduction Particles
polypyrimidine tract binding protein 3
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000364024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178164.3-1834s21c1
Sequence:CCGGCATCTGACCTTCCCGTGAAATCTCGAGATTTCACGGGAAGGTCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178164.3-395s21c1
Sequence:CCGGGAAGCAGAGGTCATATCATTACTCGAGTAATGATATGACCTCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178164.2-313s21c1
Sequence:CCGGCACCGAAGCAGAGGTCATATCCTCGAGGATATGACCTCTGCTTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306571    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178164.2-2257s21c1
Sequence:CCGGTACCAGATATTTGCATCTATTCTCGAGAATAGATGCAAATATCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178164.2-344s21c1
Sequence:CCGGCCATTTGGCAAAGTAACTAATCTCGAGATTAGTTACTTTGCCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178164.2-638s21c1
Sequence:CCGGAGCCCTGTGCTCCGGATAATTCTCGAGAATTATCCGGAGCACAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178164.2-419s21c1
Sequence:CCGGGCTGCTGTTACTATGATAAATCTCGAGATTTATCATAGTAACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178164.3-1064s21c1
Sequence:CCGGTTTGGTGCACCGGGTATAATGCTCGAGCATTATACCCGGTGCACCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178164.3-717s21c1
Sequence:CCGGGCCCTGTGCTCCGGATAATTACTCGAGTAATTATCCGGAGCACAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178164.1-1770s1c1
Sequence:CCGGCCCGTGAAATTGTCTCCTTATCTCGAGATAAGGAGACAATTTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178164.1-1205s1c1
Sequence:CCGGCCTGACTTTATCACACCACATCTCGAGATGTGGTGTGATAAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178164.1-422s1c1
Sequence:CCGGGCTGCTGTTACTATGATAAATCTCGAGATTTATCATAGTAACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178164.1-1490s1c1
Sequence:CCGGCCCGGCTCAAAGAATTTCCAACTCGAGTTGGAAATTCTTTGAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178164.1-1688s1c1
Sequence:CCGGGCTCTTATTGAGCTTCACAATCTCGAGATTGTGAAGCTCAATAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005156
VALIDATED
PTBP3 MISSION shRNA Bacterial Glycerol Stock
polypyrimidine tract binding protein 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000303472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005156.4-2144s21c1
Sequence:CCGGGATCAGCCTTATACAACATTTCTCGAGAAATGTTGTATAAGGCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005156.4-689s21c1
Sequence:CCGGGAGCCCTGTGCTTCGAATAATCTCGAGATTATTCGAAGCACAGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005156.4-1038s21c1
Sequence:CCGGTTTGGTGCACCGGGTATAATTCTCGAGAATTATACCCGGTGCACCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005156.4-1487s21c1
Sequence:CCGGCCAAGGTCTGACTAAGGATTTCTCGAGAAATCCTTAGTCAGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005156.5-2135s21c1
Sequence:CCGGTTAGATTTGAAGAGGATTAACCTCGAGGTTAATCCTCTTCAAATCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005156.5-860s21c1
Sequence:CCGGCAGTATGCTGACCCAGTAAATCTCGAGATTTACTGGGTCAGCATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005156.5-428s21c1
Sequence:CCGGCCATTTGGCAAAGTAACTAATCTCGAGATTAGTTACTTTGCCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005156.3-467s1c1
Sequence:CCGGGCCGTTACTATGGTGAATTATCTCGAGATAATTCACCATAGTAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005156.3-1774s1c1
Sequence:CCGGCCTCAGAGTTTCCTTCTCAAACTCGAGTTTGAGAAGGAAACTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005156.3-1480s1c1
Sequence:CCGGCCAAGGTCTGACTAAGGATTTCTCGAGAAATCCTTAGTCAGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005156.3-240s1c1
Sequence:CCGGCCATGAATAGTTCTACTCCTTCTCGAGAAGGAGTAGAACTATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005156.3-924s1c1
Sequence:CCGGCCAGCCTTAATGTGAAATATACTCGAGTATATTTCACATTAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005156
VALIDATED
PTBP3 MISSION shRNA shRNA Plasmid DNA
polypyrimidine tract binding protein 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000303472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005156.4-2144s21c1
Sequence:CCGGGATCAGCCTTATACAACATTTCTCGAGAAATGTTGTATAAGGCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005156.4-689s21c1
Sequence:CCGGGAGCCCTGTGCTTCGAATAATCTCGAGATTATTCGAAGCACAGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005156.4-1038s21c1
Sequence:CCGGTTTGGTGCACCGGGTATAATTCTCGAGAATTATACCCGGTGCACCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005156.4-1487s21c1
Sequence:CCGGCCAAGGTCTGACTAAGGATTTCTCGAGAAATCCTTAGTCAGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005156.5-2135s21c1
Sequence:CCGGTTAGATTTGAAGAGGATTAACCTCGAGGTTAATCCTCTTCAAATCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005156.5-860s21c1
Sequence:CCGGCAGTATGCTGACCCAGTAAATCTCGAGATTTACTGGGTCAGCATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005156.5-428s21c1
Sequence:CCGGCCATTTGGCAAAGTAACTAATCTCGAGATTAGTTACTTTGCCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005156.3-467s1c1
Sequence:CCGGGCCGTTACTATGGTGAATTATCTCGAGATAATTCACCATAGTAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005156.3-1774s1c1
Sequence:CCGGCCTCAGAGTTTCCTTCTCAAACTCGAGTTTGAGAAGGAAACTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005156.3-1480s1c1
Sequence:CCGGCCAAGGTCTGACTAAGGATTTCTCGAGAAATCCTTAGTCAGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005156.3-240s1c1
Sequence:CCGGCCATGAATAGTTCTACTCCTTCTCGAGAAGGAGTAGAACTATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005156.3-924s1c1
Sequence:CCGGCCAGCCTTAATGTGAAATATACTCGAGTATATTTCACATTAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005156
VALIDATED
PTBP3 MISSION shRNA Lentiviral Transduction Particles
polypyrimidine tract binding protein 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000303472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005156.4-2144s21c1
Sequence:CCGGGATCAGCCTTATACAACATTTCTCGAGAAATGTTGTATAAGGCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005156.4-689s21c1
Sequence:CCGGGAGCCCTGTGCTTCGAATAATCTCGAGATTATTCGAAGCACAGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005156.4-1038s21c1
Sequence:CCGGTTTGGTGCACCGGGTATAATTCTCGAGAATTATACCCGGTGCACCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005156.4-1487s21c1
Sequence:CCGGCCAAGGTCTGACTAAGGATTTCTCGAGAAATCCTTAGTCAGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_005156.5-2135s21c1
Sequence:CCGGTTAGATTTGAAGAGGATTAACCTCGAGGTTAATCCTCTTCAAATCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005156.5-860s21c1
Sequence:CCGGCAGTATGCTGACCCAGTAAATCTCGAGATTTACTGGGTCAGCATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005156.5-428s21c1
Sequence:CCGGCCATTTGGCAAAGTAACTAATCTCGAGATTAGTTACTTTGCCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005156.3-467s1c1
Sequence:CCGGGCCGTTACTATGGTGAATTATCTCGAGATAATTCACCATAGTAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005156.3-1774s1c1
Sequence:CCGGCCTCAGAGTTTCCTTCTCAAACTCGAGTTTGAGAAGGAAACTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005156.3-1480s1c1
Sequence:CCGGCCAAGGTCTGACTAAGGATTTCTCGAGAAATCCTTAGTCAGACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005156.3-240s1c1
Sequence:CCGGCCATGAATAGTTCTACTCCTTCTCGAGAAGGAGTAGAACTATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005156.3-924s1c1
Sequence:CCGGCCAGCCTTAATGTGAAATATACTCGAGTATATTTCACATTAAGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks