EMAIL THIS PAGE TO A FRIEND

PTER

phosphotriesterase related

Synonyms: HPHRP RPR-1
UniProtKB ID: Q96BW5, B0YJ77, B3KTF5, D3DRU0, Q9BY46
Gene ID:
Mouse(19212) phosphotriesterase related
Rat(63852) phosphotriesterase related
Zebrafish(751664) phosphotriesterase related
domestic cat(101090777) phosphotriesterase related
dog(477994) phosphotriesterase related
chicken(420525) phosphotriesterase related
naked mole-rat(101722260) phosphotriesterase related
domestic guinea pig(100724989) phosphotriesterase related
cow(782020) phosphotriesterase related
sheep(101109988) phosphotriesterase related
155 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008961 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008961 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008961 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001001484 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001484 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001484 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU084171 MISSION® esiRNA esiRNA human PTER (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001484 Rosetta Predictions human pricing
NM_030664 Rosetta Predictions human pricing
NM_022224 Rosetta Predictions rat pricing
NM_008961 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001484 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193125 predicted 1058
2 SASI_Hs01_00193126 predicted 684
3 SASI_Hs01_00193127 predicted 882
4 SASI_Hs01_00193128 predicted 1010
5 SASI_Hs01_00193129 predicted 959
6 SASI_Hs01_00193130 predicted 1347
7 SASI_Hs01_00193131 predicted 1382
8 SASI_Hs01_00193132 predicted 1301
9 SASI_Hs02_00303791 predicted 583
10 SASI_Hs01_00193133 predicted 1404
11 SASI_Hs01_00193134 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030664 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202576 predicted 1002
2 SASI_Hs01_00202577 predicted 633
3 SASI_Hs01_00202578 predicted 824
4 SASI_Hs01_00202579 predicted 947
5 SASI_Hs01_00202580 predicted 897
6 SASI_Hs01_00202581 predicted 1293
7 SASI_Hs01_00202582 predicted 1324
8 SASI_Hs01_00202583 predicted 1244
9 SASI_Hs02_00358249 predicted 524
10 SASI_Hs01_00202584 predicted 1344
11 SASI_Hs01_00202585 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022224 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067431 predicted 756
2 SASI_Rn01_00067432 predicted 311
3 SASI_Rn01_00067433 predicted 482
4 SASI_Rn01_00067434 predicted 424
5 SASI_Rn01_00067435 predicted 681
6 SASI_Rn01_00067437 predicted 836
7 SASI_Rn01_00067438 predicted 950
8 SASI_Rn01_00067439 predicted 242
9 SASI_Rn02_00262987 predicted 1080
10 SASI_Rn02_00262988 predicted 859
11 SASI_Rn01_00067430 predicted 811
12 SASI_Rn01_00067436 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008961 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315035 predicted 427
2 SASI_Mm01_00183186 predicted 876
3 SASI_Mm01_00183187 predicted 268
4 SASI_Mm01_00183188 predicted 668
5 SASI_Mm01_00183189 predicted 1199
6 SASI_Mm02_00315036 predicted 606
7 SASI_Mm02_00315037 predicted 801
8 SASI_Mm01_00183190 predicted 1305
9 SASI_Mm01_00183191 predicted 1010
10 SASI_Mm01_00183192 predicted 1123
11 SASI_Mm01_00183185 predicted 614
12 SASI_Mm01_00183193 predicted 1322
13 SASI_Mm01_00183194 predicted 1064
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008961
PTER MISSION shRNA Bacterial Glycerol Stock
phosphotriesterase related
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008961.2-1418s21c1
Sequence:CCGGCCCATTGTCTTTCCTTAATAACTCGAGTTATTAAGGAAAGACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008961.2-809s21c1
Sequence:CCGGCCATTCCAGATAATCCGTATACTCGAGTATACGGATTATCTGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008961.2-673s21c1
Sequence:CCGGGTGTGGAGTTATTGGAGAAATCTCGAGATTTCTCCAATAACTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008961.2-382s21c1
Sequence:CCGGCCATCGAGAGAACCTTCAGTTCTCGAGAACTGAAGGTTCTCTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008961.1-1335s1c1
Sequence:CCGGCCCATTGTCTTTCCTTAATAACTCGAGTTATTAAGGAAAGACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008961.1-299s1c1
Sequence:CCGGCCATCGAGAGAACCTTCAGTTCTCGAGAACTGAAGGTTCTCTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008961.1-590s1c1
Sequence:CCGGGTGTGGAGTTATTGGAGAAATCTCGAGATTTCTCCAATAACTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008961.1-726s1c1
Sequence:CCGGCCATTCCAGATAATCCGTATACTCGAGTATACGGATTATCTGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008961.1-1124s1c1
Sequence:CCGGCCCTAAACAATGGCTGACTTTCTCGAGAAAGTCAGCCATTGTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008961
PTER MISSION shRNA shRNA Plasmid DNA
phosphotriesterase related
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008961.2-1418s21c1
Sequence:CCGGCCCATTGTCTTTCCTTAATAACTCGAGTTATTAAGGAAAGACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008961.2-809s21c1
Sequence:CCGGCCATTCCAGATAATCCGTATACTCGAGTATACGGATTATCTGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008961.2-673s21c1
Sequence:CCGGGTGTGGAGTTATTGGAGAAATCTCGAGATTTCTCCAATAACTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008961.2-382s21c1
Sequence:CCGGCCATCGAGAGAACCTTCAGTTCTCGAGAACTGAAGGTTCTCTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008961.1-1335s1c1
Sequence:CCGGCCCATTGTCTTTCCTTAATAACTCGAGTTATTAAGGAAAGACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008961.1-299s1c1
Sequence:CCGGCCATCGAGAGAACCTTCAGTTCTCGAGAACTGAAGGTTCTCTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008961.1-590s1c1
Sequence:CCGGGTGTGGAGTTATTGGAGAAATCTCGAGATTTCTCCAATAACTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008961.1-726s1c1
Sequence:CCGGCCATTCCAGATAATCCGTATACTCGAGTATACGGATTATCTGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008961.1-1124s1c1
Sequence:CCGGCCCTAAACAATGGCTGACTTTCTCGAGAAAGTCAGCCATTGTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008961
PTER MISSION shRNA Lentiviral Transduction Particles
phosphotriesterase related
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332529    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008961.2-1418s21c1
Sequence:CCGGCCCATTGTCTTTCCTTAATAACTCGAGTTATTAAGGAAAGACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008961.2-809s21c1
Sequence:CCGGCCATTCCAGATAATCCGTATACTCGAGTATACGGATTATCTGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008961.2-673s21c1
Sequence:CCGGGTGTGGAGTTATTGGAGAAATCTCGAGATTTCTCCAATAACTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008961.2-382s21c1
Sequence:CCGGCCATCGAGAGAACCTTCAGTTCTCGAGAACTGAAGGTTCTCTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008961.1-1335s1c1
Sequence:CCGGCCCATTGTCTTTCCTTAATAACTCGAGTTATTAAGGAAAGACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008961.1-299s1c1
Sequence:CCGGCCATCGAGAGAACCTTCAGTTCTCGAGAACTGAAGGTTCTCTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008961.1-590s1c1
Sequence:CCGGGTGTGGAGTTATTGGAGAAATCTCGAGATTTCTCCAATAACTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008961.1-726s1c1
Sequence:CCGGCCATTCCAGATAATCCGTATACTCGAGTATACGGATTATCTGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008961.1-1124s1c1
Sequence:CCGGCCCTAAACAATGGCTGACTTTCTCGAGAAAGTCAGCCATTGTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001484
VALIDATED
PTER MISSION shRNA Bacterial Glycerol Stock
phosphotriesterase related
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001484.1-3222s21c1
Sequence:CCGGCCTGTGAAATAAAGGGCATTTCTCGAGAAATGCCCTTTATTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001001484.1-699s21c1
Sequence:CCGGCCGATGTCCTTATGAATGAAACTCGAGTTTCATTCATAAGGACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001001484.1-351s21c1
Sequence:CCGGCCATGACCTTTGACTGCTGTTCTCGAGAACAGCAGTCAAAGGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001484.1-1285s21c1
Sequence:CCGGCCCTAAGCAATGGCTAACTTTCTCGAGAAAGTTAGCCATTGCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001484.1-3222s1c1
Sequence:CCGGCCTGTGAAATAAAGGGCATTTCTCGAGAAATGCCCTTTATTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001484.1-1061s1c1
Sequence:CCGGCCAGATATTGACATGCCTGATCTCGAGATCAGGCATGTCAATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001484.1-699s1c1
Sequence:CCGGCCGATGTCCTTATGAATGAAACTCGAGTTTCATTCATAAGGACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001484.1-1285s1c1
Sequence:CCGGCCCTAAGCAATGGCTAACTTTCTCGAGAAAGTTAGCCATTGCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001484.1-351s1c1
Sequence:CCGGCCATGACCTTTGACTGCTGTTCTCGAGAACAGCAGTCAAAGGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001484
VALIDATED
PTER MISSION shRNA shRNA Plasmid DNA
phosphotriesterase related
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001484.1-3222s21c1
Sequence:CCGGCCTGTGAAATAAAGGGCATTTCTCGAGAAATGCCCTTTATTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001001484.1-699s21c1
Sequence:CCGGCCGATGTCCTTATGAATGAAACTCGAGTTTCATTCATAAGGACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001001484.1-351s21c1
Sequence:CCGGCCATGACCTTTGACTGCTGTTCTCGAGAACAGCAGTCAAAGGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001484.1-1285s21c1
Sequence:CCGGCCCTAAGCAATGGCTAACTTTCTCGAGAAAGTTAGCCATTGCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001484.1-3222s1c1
Sequence:CCGGCCTGTGAAATAAAGGGCATTTCTCGAGAAATGCCCTTTATTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001484.1-1061s1c1
Sequence:CCGGCCAGATATTGACATGCCTGATCTCGAGATCAGGCATGTCAATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001484.1-699s1c1
Sequence:CCGGCCGATGTCCTTATGAATGAAACTCGAGTTTCATTCATAAGGACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001484.1-1285s1c1
Sequence:CCGGCCCTAAGCAATGGCTAACTTTCTCGAGAAAGTTAGCCATTGCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001484.1-351s1c1
Sequence:CCGGCCATGACCTTTGACTGCTGTTCTCGAGAACAGCAGTCAAAGGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001484
VALIDATED
PTER MISSION shRNA Lentiviral Transduction Particles
phosphotriesterase related
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290630    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001484.1-3222s21c1
Sequence:CCGGCCTGTGAAATAAAGGGCATTTCTCGAGAAATGCCCTTTATTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001001484.1-699s21c1
Sequence:CCGGCCGATGTCCTTATGAATGAAACTCGAGTTTCATTCATAAGGACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001001484.1-351s21c1
Sequence:CCGGCCATGACCTTTGACTGCTGTTCTCGAGAACAGCAGTCAAAGGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001484.1-1285s21c1
Sequence:CCGGCCCTAAGCAATGGCTAACTTTCTCGAGAAAGTTAGCCATTGCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048798    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001484.1-3222s1c1
Sequence:CCGGCCTGTGAAATAAAGGGCATTTCTCGAGAAATGCCCTTTATTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001484.1-1061s1c1
Sequence:CCGGCCAGATATTGACATGCCTGATCTCGAGATCAGGCATGTCAATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001484.1-699s1c1
Sequence:CCGGCCGATGTCCTTATGAATGAAACTCGAGTTTCATTCATAAGGACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001484.1-1285s1c1
Sequence:CCGGCCCTAAGCAATGGCTAACTTTCTCGAGAAAGTTAGCCATTGCTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001484.1-351s1c1
Sequence:CCGGCCATGACCTTTGACTGCTGTTCTCGAGAACAGCAGTCAAAGGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks