EMAIL THIS PAGE TO A FRIEND

PTF1A

pancreas specific transcription factor, 1a

Synonyms: PTF1-p48 bHLHa29
UniProtKB ID: Q7RTS3, Q9HC25
Gene ID:
Human(256297) Summary: This gene encodes a protein that is a component of the pancreas transcription factor 1 complex (PTF1) and is known to have a role in mammalian pancreatic development. The protein plays a role in determining whether cells allocated to the pancreatic buds continue towards pancreatic organogenesis or revert back to duodenal fates. The protein is thought to be involved in the maintenance of exocrine pancreas-specific gene expression including elastase 1 and amylase. Mutations in this gene cause cerebellar agenesis and loss of expression is seen in ductal type pancreas cancers. [provided by RefSeq, Jul 2008]
Mouse(19213) pancreas specific transcription factor, 1a
Rat(117034) pancreas specific transcription factor, 1a
Zebrafish(368662) pancreas specific transcription factor, 1a
dog(608313) pancreas specific transcription factor, 1a
cow(781540) pancreas specific transcription factor, 1a
naked mole-rat(101703535) pancreas specific transcription factor, 1a
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018809 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018809 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018809 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178161 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178161 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178161 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178161 Rosetta Predictions human pricing
NM_053964 Rosetta Predictions rat pricing
NM_018809 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178161 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369569 predicted 1263
2 SASI_Hs02_00369570 predicted 1297
3 SASI_Hs02_00369571 predicted 958
4 SASI_Hs01_00234014 predicted 36
5 SASI_Hs02_00369572 predicted 1090
6 SASI_Hs02_00369573 predicted 965
7 SASI_Hs02_00369574 predicted 1275
8 SASI_Hs02_00369575 predicted 1229
9 SASI_Hs02_00369576 predicted 1015
10 SASI_Hs02_00369577 predicted 955
11 SASI_Hs01_00234011 predicted 832
12 SASI_Hs01_00234012 predicted 121
13 SASI_Hs01_00234013 predicted 756
14 SASI_Hs01_00234015 predicted 38
15 SASI_Hs01_00234016 predicted 68
16 SASI_Hs01_00234017 predicted 40
17 SASI_Hs01_00234018 predicted 837
18 SASI_Hs01_00234019 predicted 837
19 SASI_Hs01_00234020 predicted 40
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053964 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081786 predicted 1302
2 SASI_Rn01_00081787 predicted 1066
3 SASI_Rn02_00266938 predicted 1248
4 SASI_Rn01_00081788 predicted 388
5 SASI_Rn01_00081789 predicted 1265
6 SASI_Rn01_00081790 predicted 390
7 SASI_Rn01_00081792 predicted 1251
8 SASI_Rn01_00081793 predicted 1307
9 SASI_Rn02_00266939 predicted 266
10 SASI_Rn01_00081794 predicted 1302
11 SASI_Rn01_00081785 predicted 1281
12 SASI_Rn01_00081791 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018809 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049412 predicted 1203
2 SASI_Mm01_00049413 predicted 1149
3 SASI_Mm01_00049416 predicted 1263
4 SASI_Mm01_00049417 predicted 1189
5 SASI_Mm01_00049418 predicted 1143
6 SASI_Mm01_00049419 predicted 981
7 SASI_Mm01_00049420 predicted 1179
8 SASI_Mm01_00049421 predicted 1004
9 SASI_Mm02_00324148 predicted 1118
10 SASI_Mm02_00324149 predicted 356
11 SASI_Mm01_00049414 predicted 1001
12 SASI_Mm01_00049415 predicted 1239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018809
PTF1A MISSION shRNA Bacterial Glycerol Stock
pancreas specific transcription factor, 1a
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018809.1-1195s1c1
Sequence:CCGGCGCGTCTTTGTGCATATTGTACTCGAGTACAATATGCACAAAGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018809.1-1116s1c1
Sequence:CCGGCAACAGTAAATCTTTCGACAACTCGAGTTGTCGAAAGATTTACTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018809.1-943s1c1
Sequence:CCGGCAGAAGGTTATCATCTGCCATCTCGAGATGGCAGATGATAACCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018809.1-1119s1c1
Sequence:CCGGCAGTAAATCTTTCGACAACATCTCGAGATGTTGTCGAAAGATTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018809.1-806s1c1
Sequence:CCGGGCTTGGCCATAGGCTACATTACTCGAGTAATGTAGCCTATGGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018809.2-1067s21c1
Sequence:CCGGATATCATCCGTACAGCTAAAGCTCGAGCTTTAGCTGTACGGATGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018809.2-1145s21c1
Sequence:CCGGACGAACCACCCTTTGAGTTTGCTCGAGCAAACTCAAAGGGTGGTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018809.2-1310s21c1
Sequence:CCGGTCGAGTTAATGAAATAGATTGCTCGAGCAATCTATTTCATTAACTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018809
PTF1A MISSION shRNA shRNA Plasmid DNA
pancreas specific transcription factor, 1a
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018809.1-1195s1c1
Sequence:CCGGCGCGTCTTTGTGCATATTGTACTCGAGTACAATATGCACAAAGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018809.1-1116s1c1
Sequence:CCGGCAACAGTAAATCTTTCGACAACTCGAGTTGTCGAAAGATTTACTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018809.1-943s1c1
Sequence:CCGGCAGAAGGTTATCATCTGCCATCTCGAGATGGCAGATGATAACCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018809.1-1119s1c1
Sequence:CCGGCAGTAAATCTTTCGACAACATCTCGAGATGTTGTCGAAAGATTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018809.1-806s1c1
Sequence:CCGGGCTTGGCCATAGGCTACATTACTCGAGTAATGTAGCCTATGGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018809.2-1067s21c1
Sequence:CCGGATATCATCCGTACAGCTAAAGCTCGAGCTTTAGCTGTACGGATGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018809.2-1145s21c1
Sequence:CCGGACGAACCACCCTTTGAGTTTGCTCGAGCAAACTCAAAGGGTGGTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018809.2-1310s21c1
Sequence:CCGGTCGAGTTAATGAAATAGATTGCTCGAGCAATCTATTTCATTAACTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018809
PTF1A MISSION shRNA Lentiviral Transduction Particles
pancreas specific transcription factor, 1a
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082198    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018809.1-1195s1c1
Sequence:CCGGCGCGTCTTTGTGCATATTGTACTCGAGTACAATATGCACAAAGACGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018809.1-1116s1c1
Sequence:CCGGCAACAGTAAATCTTTCGACAACTCGAGTTGTCGAAAGATTTACTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018809.1-943s1c1
Sequence:CCGGCAGAAGGTTATCATCTGCCATCTCGAGATGGCAGATGATAACCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018809.1-1119s1c1
Sequence:CCGGCAGTAAATCTTTCGACAACATCTCGAGATGTTGTCGAAAGATTTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018809.1-806s1c1
Sequence:CCGGGCTTGGCCATAGGCTACATTACTCGAGTAATGTAGCCTATGGCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018809.2-1067s21c1
Sequence:CCGGATATCATCCGTACAGCTAAAGCTCGAGCTTTAGCTGTACGGATGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018809.2-1145s21c1
Sequence:CCGGACGAACCACCCTTTGAGTTTGCTCGAGCAAACTCAAAGGGTGGTTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018809.2-1310s21c1
Sequence:CCGGTCGAGTTAATGAAATAGATTGCTCGAGCAATCTATTTCATTAACTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178161
PTF1A MISSION shRNA Bacterial Glycerol Stock
pancreas specific transcription factor, 1a
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178161.1-42s1c1
Sequence:CCGGCGCCTTTCCTTCTTCGTACTTCTCGAGAAGTACGAAGAAGGAAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178161.1-528s1c1
Sequence:CCGGGCAGTCCATCAACGACGCCTTCTCGAGAAGGCGTCGTTGATGGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178161.1-754s1c1
Sequence:CCGGCAGAAGGTCATCATCTGCCATCTCGAGATGGCAGATGATGACCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178161.1-630s1c1
Sequence:CCGGCTACATCAACTTCCTCAGCGACTCGAGTCGCTGAGGAAGTTGATGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178161.1-834s1c1
Sequence:CCGGACACTCTCTCTCATGGACTGACTCGAGTCAGTCCATGAGAGAGAGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178161.2-880s21c1
Sequence:CCGGATTATCCGAACAGCCAAAGTCCTCGAGGACTTTGGCTGTTCGGATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178161.2-1000s21c1
Sequence:CCGGTCGGCTGAAGATCTGATTATGCTCGAGCATAATCAGATCTTCAGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178161.2-1122s21c1
Sequence:CCGGATCCTGTTGAGTTGATGAAATCTCGAGATTTCATCAACTCAACAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178161
PTF1A MISSION shRNA shRNA Plasmid DNA
pancreas specific transcription factor, 1a
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178161.1-42s1c1
Sequence:CCGGCGCCTTTCCTTCTTCGTACTTCTCGAGAAGTACGAAGAAGGAAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178161.1-528s1c1
Sequence:CCGGGCAGTCCATCAACGACGCCTTCTCGAGAAGGCGTCGTTGATGGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178161.1-754s1c1
Sequence:CCGGCAGAAGGTCATCATCTGCCATCTCGAGATGGCAGATGATGACCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178161.1-630s1c1
Sequence:CCGGCTACATCAACTTCCTCAGCGACTCGAGTCGCTGAGGAAGTTGATGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178161.1-834s1c1
Sequence:CCGGACACTCTCTCTCATGGACTGACTCGAGTCAGTCCATGAGAGAGAGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178161.2-880s21c1
Sequence:CCGGATTATCCGAACAGCCAAAGTCCTCGAGGACTTTGGCTGTTCGGATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178161.2-1000s21c1
Sequence:CCGGTCGGCTGAAGATCTGATTATGCTCGAGCATAATCAGATCTTCAGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178161.2-1122s21c1
Sequence:CCGGATCCTGTTGAGTTGATGAAATCTCGAGATTTCATCAACTCAACAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178161
PTF1A MISSION shRNA Lentiviral Transduction Particles
pancreas specific transcription factor, 1a
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178161.1-42s1c1
Sequence:CCGGCGCCTTTCCTTCTTCGTACTTCTCGAGAAGTACGAAGAAGGAAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178161.1-528s1c1
Sequence:CCGGGCAGTCCATCAACGACGCCTTCTCGAGAAGGCGTCGTTGATGGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178161.1-754s1c1
Sequence:CCGGCAGAAGGTCATCATCTGCCATCTCGAGATGGCAGATGATGACCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178161.1-630s1c1
Sequence:CCGGCTACATCAACTTCCTCAGCGACTCGAGTCGCTGAGGAAGTTGATGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178161.1-834s1c1
Sequence:CCGGACACTCTCTCTCATGGACTGACTCGAGTCAGTCCATGAGAGAGAGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178161.2-880s21c1
Sequence:CCGGATTATCCGAACAGCCAAAGTCCTCGAGGACTTTGGCTGTTCGGATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178161.2-1000s21c1
Sequence:CCGGTCGGCTGAAGATCTGATTATGCTCGAGCATAATCAGATCTTCAGCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178161.2-1122s21c1
Sequence:CCGGATCCTGTTGAGTTGATGAAATCTCGAGATTTCATCAACTCAACAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks