EMAIL THIS PAGE TO A FRIEND

PTGER1

prostaglandin E receptor 1 (subtype EP1), 42kDa

Synonyms: EP1
UniProtKB ID: P34995, Q5U5U4, Q86UH3, Q86VB5, Q8NHB2
Gene ID:
Human(5731) Summary: The protein encoded by this gene is a member of the G protein-coupled receptor family. This protein is one of four receptors identified for prostaglandin E2 (PGE2). Through a phosphatidylinositol-calcium second messenger system, G-Q proteins mediate this receptor's activity. Knockout studies in mice suggested a role of this receptor in mediating algesia and in regulation of blood pressure. Studies in mice also suggested that this gene may mediate adrenocorticotropic hormone response to bacterial endotoxin. [provided by RefSeq, Jul 2008]
Mouse(19216) prostaglandin E receptor 1 (subtype EP1)
Rat(25637) prostaglandin E receptor 1 (subtype EP1)
dog(610774) prostaglandin E receptor 1 (subtype EP1), 42kDa
domestic cat(101097794) prostaglandin E receptor 1 (subtype EP1), 42kDa
cow(507437) prostaglandin E receptor 1 (subtype EP1), 42kDa
sheep(101117842) prostaglandin E receptor 1 (subtype EP1), 42kDa
naked mole-rat(101713959) prostaglandin E receptor 1 (subtype EP1), 42kDa
Domestic Rabbit(100008680) prostaglandin E receptor 1 (subtype EP1), 42kDa
domestic guinea pig(100719923) prostaglandin E receptor 1 (subtype EP1), 42kDa
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2900708 Anti-PTGER1 / EP1 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB4300877 Anti-PTGER1 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013641 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013641 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013641 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000955 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000955 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000955 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU032901 MISSION® esiRNA esiRNA targeting mouse Ptger1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000955 Rosetta Predictions human pricing
NM_013100 Rosetta Predictions rat pricing
NM_013641 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029870 predicted 1004
2 SASI_Hs01_00029871 predicted 1002
3 SASI_Hs01_00029872 predicted 218
4 SASI_Hs01_00029873 predicted 221
5 SASI_Hs01_00029874 predicted 1073
6 SASI_Hs01_00029875 predicted 1076
7 SASI_Hs01_00029876 predicted 1146
8 SASI_Hs01_00029877 predicted 311
9 SASI_Hs01_00029878 predicted 221
10 SASI_Hs01_00029879 predicted 1011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013100 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079376 predicted 588
2 SASI_Rn01_00079377 predicted 1758
3 SASI_Rn01_00079379 predicted 699
4 SASI_Rn01_00079380 predicted 1143
5 SASI_Rn01_00079381 predicted 1942
6 SASI_Rn01_00079382 predicted 1943
7 SASI_Rn01_00079383 predicted 1838
8 SASI_Rn01_00079384 predicted 601
9 SASI_Rn02_00260870 predicted 1847
10 SASI_Rn01_00079385 predicted 1963
11 SASI_Rn01_00079378 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013641 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115916 predicted 1650
2 SASI_Mm01_00115917 predicted 935
3 SASI_Mm02_00322439 predicted 1546
4 SASI_Mm01_00115919 predicted 1844
5 SASI_Mm01_00115920 predicted 1310
6 SASI_Mm01_00115915 predicted 1804
7 SASI_Mm01_00115921 predicted 405
8 SASI_Mm01_00115922 predicted 1761
9 SASI_Mm01_00115923 predicted 1465
10 SASI_Mm02_00322440 predicted 1461
11 SASI_Mm01_00115918 predicted 1805
12 SASI_Mm01_00115924 predicted 1553
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013641
PTGER1 MISSION shRNA Bacterial Glycerol Stock
prostaglandin E receptor 1 (subtype EP1), 42kDa
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000027929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013641.1-383s1c1
Sequence:CCGGCAACAGGCGATAATGGCACATCTCGAGATGTGCCATTATCGCCTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013641.1-1317s1c1
Sequence:CCGGCCTCGCATCGTGGAACCAGATCTCGAGATCTGGTTCCACGATGCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013641.1-1159s1c1
Sequence:CCGGCGCAGGGTTCACGCACACGATCTCGAGATCGTGTGCGTGAACCCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013641.1-578s1c1
Sequence:CCGGCCCTGGTGCTTCGCCTGTATACTCGAGTATACAGGCGAAGCACCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013641
PTGER1 MISSION shRNA shRNA Plasmid DNA
prostaglandin E receptor 1 (subtype EP1), 42kDa
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000027929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013641.1-383s1c1
Sequence:CCGGCAACAGGCGATAATGGCACATCTCGAGATGTGCCATTATCGCCTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013641.1-1317s1c1
Sequence:CCGGCCTCGCATCGTGGAACCAGATCTCGAGATCTGGTTCCACGATGCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013641.1-1159s1c1
Sequence:CCGGCGCAGGGTTCACGCACACGATCTCGAGATCGTGTGCGTGAACCCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013641.1-578s1c1
Sequence:CCGGCCCTGGTGCTTCGCCTGTATACTCGAGTATACAGGCGAAGCACCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013641
PTGER1 MISSION shRNA Lentiviral Transduction Particles
prostaglandin E receptor 1 (subtype EP1), 42kDa
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000027929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013641.1-383s1c1
Sequence:CCGGCAACAGGCGATAATGGCACATCTCGAGATGTGCCATTATCGCCTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013641.1-1317s1c1
Sequence:CCGGCCTCGCATCGTGGAACCAGATCTCGAGATCTGGTTCCACGATGCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013641.1-1159s1c1
Sequence:CCGGCGCAGGGTTCACGCACACGATCTCGAGATCGTGTGCGTGAACCCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013641.1-578s1c1
Sequence:CCGGCCCTGGTGCTTCGCCTGTATACTCGAGTATACAGGCGAAGCACCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000955
PTGER1 MISSION shRNA Bacterial Glycerol Stock
prostaglandin E receptor 1 (subtype EP1), 42kDa
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000955.2-769s1c1
Sequence:CCGGCGCGCTGGTGTGCAACACGCTCTCGAGAGCGTGTTGCACACCAGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000955.2-1195s1c1
Sequence:CCGGGCGCCAACTGCTTCGCCTCTTCTCGAGAAGAGGCGAAGCAGTTGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000955.2-394s1c1
Sequence:CCGGCGCGCTGGTGCTGCGTCTGTACTCGAGTACAGACGCAGCACCAGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000955.2-1037s21c1
Sequence:CCGGTGCATCTGCTGGAGCCCAATGCTCGAGCATTGGGCTCCAGCAGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000955.2-1046s21c1
Sequence:CCGGTGGAGCCCAATGCTGGTGTTGCTCGAGCAACACCAGCATTGGGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000955.2-1022s21c1
Sequence:CCGGATCATGGTGGTGTCGTGCATCCTCGAGGATGCACGACACCACCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000955
PTGER1 MISSION shRNA shRNA Plasmid DNA
prostaglandin E receptor 1 (subtype EP1), 42kDa
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000955.2-769s1c1
Sequence:CCGGCGCGCTGGTGTGCAACACGCTCTCGAGAGCGTGTTGCACACCAGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000955.2-1195s1c1
Sequence:CCGGGCGCCAACTGCTTCGCCTCTTCTCGAGAAGAGGCGAAGCAGTTGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000955.2-394s1c1
Sequence:CCGGCGCGCTGGTGCTGCGTCTGTACTCGAGTACAGACGCAGCACCAGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000955.2-1037s21c1
Sequence:CCGGTGCATCTGCTGGAGCCCAATGCTCGAGCATTGGGCTCCAGCAGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000955.2-1046s21c1
Sequence:CCGGTGGAGCCCAATGCTGGTGTTGCTCGAGCAACACCAGCATTGGGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000955.2-1022s21c1
Sequence:CCGGATCATGGTGGTGTCGTGCATCCTCGAGGATGCACGACACCACCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000955
PTGER1 MISSION shRNA Lentiviral Transduction Particles
prostaglandin E receptor 1 (subtype EP1), 42kDa
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000955.2-769s1c1
Sequence:CCGGCGCGCTGGTGTGCAACACGCTCTCGAGAGCGTGTTGCACACCAGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000955.2-1195s1c1
Sequence:CCGGGCGCCAACTGCTTCGCCTCTTCTCGAGAAGAGGCGAAGCAGTTGGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000955.2-394s1c1
Sequence:CCGGCGCGCTGGTGCTGCGTCTGTACTCGAGTACAGACGCAGCACCAGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000955.2-1037s21c1
Sequence:CCGGTGCATCTGCTGGAGCCCAATGCTCGAGCATTGGGCTCCAGCAGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000955.2-1046s21c1
Sequence:CCGGTGGAGCCCAATGCTGGTGTTGCTCGAGCAACACCAGCATTGGGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000955.2-1022s21c1
Sequence:CCGGATCATGGTGGTGTCGTGCATCCTCGAGGATGCACGACACCACCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks