EMAIL THIS PAGE TO A FRIEND

PTGER3

prostaglandin E receptor 3 (subtype EP3)

Synonyms: EP3 EP3-I EP3-II EP3-III EP3-IV EP3e PGE2-R
Gene ID:
Human(5733) Summary: The protein encoded by this gene is a member of the G-protein coupled receptor family. This protein is one of four receptors identified for prostaglandin E2 (PGE2). This receptor may have many biological functions, which involve digestion, nervous system, kidney reabsorption, and uterine contraction activities. Studies of the mouse counterpart suggest that this receptor may also mediate adrenocorticotropic hormone response as well as fever generation in response to exogenous and endogenous stimuli. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Mouse(19218) prostaglandin E receptor 3 (subtype EP3)
Rat(24929) prostaglandin E receptor 3 (subtype EP3)
chicken(429116) prostaglandin E receptor 3 (subtype EP3)
domestic cat(101083952) prostaglandin E receptor 3 (subtype EP3)
Horse(100053557) prostaglandin E receptor 3 (subtype EP3)
dog(403430) prostaglandin E receptor 3 (subtype EP3)
cow(282330) prostaglandin E receptor 3 (subtype EP3)
sheep(101105547) prostaglandin E receptor 3 (subtype EP3)
sheep(443496) prostaglandin E receptor 3 (subtype EP3)
naked mole-rat(101717039) prostaglandin E receptor 3 (subtype EP3)
Domestic Rabbit(100009389) prostaglandin E receptor 3 (subtype EP3)
domestic guinea pig(100719742) prostaglandin E receptor 3 (subtype EP3)
481 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011196 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011196 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011196 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000957 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000957 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000957 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198719 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198719 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198719 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU159061 MISSION® esiRNA esiRNA human PTGER3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000957 Rosetta Predictions human pricing
NM_001126044 Rosetta Predictions human pricing
NM_198712 Rosetta Predictions human pricing
NM_198713 Rosetta Predictions human pricing
NM_198714 Rosetta Predictions human pricing
NM_198715 Rosetta Predictions human pricing
NM_198716 Rosetta Predictions human pricing
NM_198717 Rosetta Predictions human pricing
NM_198718 Rosetta Predictions human pricing
NM_198719 Rosetta Predictions human pricing
NM_198720 Rosetta Predictions human pricing
NM_012704 Rosetta Predictions rat pricing
NM_011196 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303570 predicted 966
2 SASI_Hs01_00232637 predicted 716
3 SASI_Hs01_00232639 predicted 879
4 SASI_Hs01_00232640 predicted 389
5 SASI_Hs01_00232641 predicted 397
6 SASI_Hs01_00232642 predicted 270
7 SASI_Hs02_00303571 predicted 713
8 SASI_Hs01_00232644 predicted 385
9 SASI_Hs01_00232645 predicted 884
10 SASI_Hs01_00232646 predicted 396
11 SASI_Hs01_00232638 predicted 564
12 SASI_Hs01_00232643 predicted 949
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126044 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327987 predicted 964
2 SASI_Hs02_00327988 predicted 717
3 SASI_Hs02_00327989 predicted 879
4 SASI_Hs02_00327990 predicted 385
5 SASI_Hs02_00327991 predicted 395
6 SASI_Hs02_00327992 predicted 278
7 SASI_Hs02_00327993 predicted 714
8 SASI_Hs02_00327994 predicted 392
9 SASI_Hs02_00327995 predicted 884
10 SASI_Hs02_00327996 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198712 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372296 predicted 965
2 SASI_Hs01_00052198 predicted 717
3 SASI_Hs01_00052200 predicted 877
4 SASI_Hs01_00052201 predicted 390
5 SASI_Hs01_00052202 predicted 391
6 SASI_Hs01_00052203 predicted 278
7 SASI_Hs02_00372297 predicted 710
8 SASI_Hs01_00052205 predicted 387
9 SASI_Hs01_00052206 predicted 877
10 SASI_Hs01_00052207 predicted 393
11 SASI_Hs01_00052199 predicted 562
12 SASI_Hs01_00052204 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198713 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372298 predicted 967
2 SASI_Hs01_00103971 predicted 720
3 SASI_Hs01_00103973 predicted 881
4 SASI_Hs01_00103974 predicted 390
5 SASI_Hs01_00103975 predicted 397
6 SASI_Hs01_00103976 predicted 273
7 SASI_Hs02_00372299 predicted 715
8 SASI_Hs01_00103978 predicted 393
9 SASI_Hs01_00103979 predicted 881
10 SASI_Hs01_00103980 predicted 396
11 SASI_Hs01_00103972 predicted 564
12 SASI_Hs01_00103977 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198714 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372300 predicted 966
2 SASI_Hs01_00136600 predicted 719
3 SASI_Hs01_00136602 predicted 875
4 SASI_Hs01_00136603 predicted 392
5 SASI_Hs01_00136604 predicted 391
6 SASI_Hs01_00136605 predicted 275
7 SASI_Hs02_00372301 predicted 711
8 SASI_Hs01_00136607 predicted 387
9 SASI_Hs01_00136608 predicted 879
10 SASI_Hs01_00136609 predicted 395
11 SASI_Hs01_00136601 predicted 562
12 SASI_Hs01_00136606 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372302 predicted 1245
2 SASI_Hs02_00372303 predicted 1338
3 SASI_Hs02_00372304 predicted 1436
4 SASI_Hs02_00372305 predicted 1257
5 SASI_Hs02_00372306 predicted 1357
6 SASI_Hs02_00372307 predicted 1185
7 SASI_Hs02_00372308 predicted 1444
8 SASI_Hs02_00372309 predicted 1401
9 SASI_Hs02_00372310 predicted 1271
10 SASI_Hs02_00372311 predicted 1638
11 SASI_Hs01_00177619 predicted 718
12 SASI_Hs01_00177620 predicted 555
13 SASI_Hs01_00177621 predicted 885
14 SASI_Hs01_00177622 predicted 391
15 SASI_Hs01_00177623 predicted 399
16 SASI_Hs01_00177624 predicted 284
17 SASI_Hs01_00177625 predicted 944
18 SASI_Hs01_00177626 predicted 397
19 SASI_Hs01_00177627 predicted 880
20 SASI_Hs01_00177628 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372312 predicted 967
2 SASI_Hs01_00115188 predicted 720
3 SASI_Hs01_00115190 predicted 880
4 SASI_Hs01_00115191 predicted 385
5 SASI_Hs01_00115192 predicted 391
6 SASI_Hs01_00115193 predicted 272
7 SASI_Hs02_00372313 predicted 713
8 SASI_Hs01_00115195 predicted 387
9 SASI_Hs01_00115196 predicted 875
10 SASI_Hs01_00115197 predicted 397
11 SASI_Hs01_00115189 predicted 564
12 SASI_Hs01_00115194 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372314 predicted 969
2 SASI_Hs01_00197857 predicted 713
3 SASI_Hs01_00197859 predicted 878
4 SASI_Hs01_00197860 predicted 390
5 SASI_Hs01_00197861 predicted 398
6 SASI_Hs01_00197862 predicted 273
7 SASI_Hs02_00372315 predicted 711
8 SASI_Hs01_00197864 predicted 385
9 SASI_Hs01_00197865 predicted 883
10 SASI_Hs01_00197866 predicted 401
11 SASI_Hs01_00197858 predicted 560
12 SASI_Hs01_00197863 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198718 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372316 predicted 962
2 SASI_Hs01_00056505 predicted 721
3 SASI_Hs01_00056507 predicted 880
4 SASI_Hs01_00056508 predicted 392
5 SASI_Hs01_00056509 predicted 395
6 SASI_Hs01_00056510 predicted 271
7 SASI_Hs02_00372317 predicted 708
8 SASI_Hs01_00056512 predicted 393
9 SASI_Hs01_00056513 predicted 884
10 SASI_Hs01_00056514 predicted 399
11 SASI_Hs01_00056506 predicted 558
12 SASI_Hs01_00056511 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198719 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372318 predicted 968
2 SASI_Hs01_00111358 predicted 721
3 SASI_Hs01_00111360 predicted 875
4 SASI_Hs01_00111361 predicted 385
5 SASI_Hs01_00111362 predicted 398
6 SASI_Hs01_00111363 predicted 270
7 SASI_Hs02_00372319 predicted 717
8 SASI_Hs01_00111365 predicted 385
9 SASI_Hs01_00111366 predicted 883
10 SASI_Hs01_00111367 predicted 395
11 SASI_Hs01_00111359 predicted 564
12 SASI_Hs01_00111364 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035556 predicted 719
2 SASI_Hs01_00035557 predicted 558
3 SASI_Hs01_00035558 predicted 879
4 SASI_Hs01_00035559 predicted 389
5 SASI_Hs01_00035560 predicted 396
6 SASI_Hs01_00035561 predicted 276
7 SASI_Hs01_00035562 predicted 942
8 SASI_Hs01_00035563 predicted 393
9 SASI_Hs01_00035564 predicted 884
10 SASI_Hs01_00035565 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012704 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055118 predicted 956
2 SASI_Rn01_00055119 predicted 907
3 SASI_Rn01_00055121 predicted 418
4 SASI_Rn01_00055122 predicted 228
5 SASI_Rn01_00055123 predicted 1025
6 SASI_Rn01_00055124 predicted 755
7 SASI_Rn01_00055125 predicted 505
8 SASI_Rn01_00055126 predicted 889
9 SASI_Rn01_00055127 predicted 269
10 SASI_Rn02_00260020 predicted 901
11 SASI_Rn01_00055120 predicted 926
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011196 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111273 predicted 940
2 SASI_Mm01_00111274 predicted 1031
3 SASI_Mm01_00111275 predicted 1156
4 SASI_Mm01_00111277 predicted 927
5 SASI_Mm01_00111278 predicted 938
6 SASI_Mm01_00111279 predicted 1337
7 SASI_Mm01_00111280 predicted 1450
8 SASI_Mm01_00111281 predicted 1026
9 SASI_Mm01_00111282 predicted 1125
10 SASI_Mm02_00320110 predicted 1414
11 SASI_Mm01_00111276 predicted 1089
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011196
PTGER3 MISSION shRNA Bacterial Glycerol Stock
prostaglandin E receptor 3 (subtype EP3)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011196.1-1088s1c1
Sequence:CCGGCTGCTAAGAAAGATCCTTCTTCTCGAGAAGAAGGATCTTTCTTAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011196.1-1074s1c1
Sequence:CCGGCCTGGGTTTATCTGCTGCTAACTCGAGTTAGCAGCAGATAAACCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011196.1-1684s1c1
Sequence:CCGGGCTCCTCAGTAATTCAGGAATCTCGAGATTCCTGAATTACTGAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011196.1-934s1c1
Sequence:CCGGGCCGCTATTGATAATGATGTTCTCGAGAACATCATTATCAATAGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011196.1-448s1c1
Sequence:CCGGCGGGCTAACCATGACAGTGTTCTCGAGAACACTGTCATGGTTAGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011196.2-168s21c1
Sequence:CCGCCAGCAACCTGTCAAGTACTACCTCGAGGTAGTACTTGACAGGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011196.2-1284s21c1
Sequence:CCGGGACAAGCTTTCTTAGGATAATCTCGAGATTATCCTAAGAAAGCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011196.2-1456s21c1
Sequence:CCGGGATAGTCTGACTCTTCTAAATCTCGAGATTTAGAAGAGTCAGACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011196.2-1026s21c1
Sequence:CCGGGGAGTGCAATTCCTTTCTAATCTCGAGATTAGAAAGGAATTGCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011196.2-1529s21c1
Sequence:CCGGGAGCAAATGTTCATCTAATAACTCGAGTTATTAGATGAACATTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011196
PTGER3 MISSION shRNA shRNA Plasmid DNA
prostaglandin E receptor 3 (subtype EP3)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011196.1-1088s1c1
Sequence:CCGGCTGCTAAGAAAGATCCTTCTTCTCGAGAAGAAGGATCTTTCTTAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011196.1-1074s1c1
Sequence:CCGGCCTGGGTTTATCTGCTGCTAACTCGAGTTAGCAGCAGATAAACCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011196.1-1684s1c1
Sequence:CCGGGCTCCTCAGTAATTCAGGAATCTCGAGATTCCTGAATTACTGAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011196.1-934s1c1
Sequence:CCGGGCCGCTATTGATAATGATGTTCTCGAGAACATCATTATCAATAGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011196.1-448s1c1
Sequence:CCGGCGGGCTAACCATGACAGTGTTCTCGAGAACACTGTCATGGTTAGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011196.2-168s21c1
Sequence:CCGCCAGCAACCTGTCAAGTACTACCTCGAGGTAGTACTTGACAGGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011196.2-1284s21c1
Sequence:CCGGGACAAGCTTTCTTAGGATAATCTCGAGATTATCCTAAGAAAGCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011196.2-1456s21c1
Sequence:CCGGGATAGTCTGACTCTTCTAAATCTCGAGATTTAGAAGAGTCAGACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011196.2-1026s21c1
Sequence:CCGGGGAGTGCAATTCCTTTCTAATCTCGAGATTAGAAAGGAATTGCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011196.2-1529s21c1
Sequence:CCGGGAGCAAATGTTCATCTAATAACTCGAGTTATTAGATGAACATTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011196
PTGER3 MISSION shRNA Lentiviral Transduction Particles
prostaglandin E receptor 3 (subtype EP3)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011196.1-1088s1c1
Sequence:CCGGCTGCTAAGAAAGATCCTTCTTCTCGAGAAGAAGGATCTTTCTTAGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011196.1-1074s1c1
Sequence:CCGGCCTGGGTTTATCTGCTGCTAACTCGAGTTAGCAGCAGATAAACCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011196.1-1684s1c1
Sequence:CCGGGCTCCTCAGTAATTCAGGAATCTCGAGATTCCTGAATTACTGAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011196.1-934s1c1
Sequence:CCGGGCCGCTATTGATAATGATGTTCTCGAGAACATCATTATCAATAGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011196.1-448s1c1
Sequence:CCGGCGGGCTAACCATGACAGTGTTCTCGAGAACACTGTCATGGTTAGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011196.2-168s21c1
Sequence:CCGCCAGCAACCTGTCAAGTACTACCTCGAGGTAGTACTTGACAGGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011196.2-1284s21c1
Sequence:CCGGGACAAGCTTTCTTAGGATAATCTCGAGATTATCCTAAGAAAGCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011196.2-1456s21c1
Sequence:CCGGGATAGTCTGACTCTTCTAAATCTCGAGATTTAGAAGAGTCAGACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011196.2-1026s21c1
Sequence:CCGGGGAGTGCAATTCCTTTCTAATCTCGAGATTAGAAAGGAATTGCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011196.2-1529s21c1
Sequence:CCGGGAGCAAATGTTCATCTAATAACTCGAGTTATTAGATGAACATTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000957
PTGER3 MISSION shRNA Bacterial Glycerol Stock
prostaglandin E receptor 3 (subtype EP3)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000957.2-882s1c1
Sequence:CCGGCGGGACTAGCTCTTCGCATAACTCGAGTTATGCGAAGAGCTAGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000957.2-1513s1c1
Sequence:CCGGCTTGAAGATAAATCTGCCTAACTCGAGTTAGGCAGATTTATCTTCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000957.2-1122s1c1
Sequence:CCGGGCTCCTGATAATGATGTTGAACTCGAGTTCAACATCATTATCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000957.2-1194s1c1
Sequence:CCGGGCAGAAAGAATGCAACTTCTTCTCGAGAAGAAGTTGCATTCTTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000957.2-1258s1c1
Sequence:CCGGCCTTGGGTTTACCTGCTGTTACTCGAGTAACAGCAGGTAAACCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000957
PTGER3 MISSION shRNA shRNA Plasmid DNA
prostaglandin E receptor 3 (subtype EP3)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000957.2-882s1c1
Sequence:CCGGCGGGACTAGCTCTTCGCATAACTCGAGTTATGCGAAGAGCTAGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000957.2-1513s1c1
Sequence:CCGGCTTGAAGATAAATCTGCCTAACTCGAGTTAGGCAGATTTATCTTCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000957.2-1122s1c1
Sequence:CCGGGCTCCTGATAATGATGTTGAACTCGAGTTCAACATCATTATCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000957.2-1194s1c1
Sequence:CCGGGCAGAAAGAATGCAACTTCTTCTCGAGAAGAAGTTGCATTCTTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000957.2-1258s1c1
Sequence:CCGGCCTTGGGTTTACCTGCTGTTACTCGAGTAACAGCAGGTAAACCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000957
PTGER3 MISSION shRNA Lentiviral Transduction Particles
prostaglandin E receptor 3 (subtype EP3)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000957.2-882s1c1
Sequence:CCGGCGGGACTAGCTCTTCGCATAACTCGAGTTATGCGAAGAGCTAGTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000957.2-1513s1c1
Sequence:CCGGCTTGAAGATAAATCTGCCTAACTCGAGTTAGGCAGATTTATCTTCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000957.2-1122s1c1
Sequence:CCGGGCTCCTGATAATGATGTTGAACTCGAGTTCAACATCATTATCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000957.2-1194s1c1
Sequence:CCGGGCAGAAAGAATGCAACTTCTTCTCGAGAAGAAGTTGCATTCTTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000957.2-1258s1c1
Sequence:CCGGCCTTGGGTTTACCTGCTGTTACTCGAGTAACAGCAGGTAAACCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198719
PTGER3 MISSION shRNA Bacterial Glycerol Stock
prostaglandin E receptor 3 (subtype EP3)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000357982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198719.1-1114s21c1
Sequence:CCGGTGGTCTCCGCTCCTGATAATGCTCGAGCATTATCAGGAGCGGAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198719.1-1552s21c1
Sequence:CCGGTACCCATGGAGATCAACTTTACTCGAGTAAAGTTGATCTCCATGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198719.1-1374s21c1
Sequence:CCGGCTTGATGTGGAGCGACCATTTCTCGAGAAATGGTCGCTCCACATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198719.1-1467s21c1
Sequence:CCGGCCACCTGAGAAGGATAATTATCTCGAGATAATTATCCTTCTCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198719
PTGER3 MISSION shRNA shRNA Plasmid DNA
prostaglandin E receptor 3 (subtype EP3)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000357982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198719.1-1114s21c1
Sequence:CCGGTGGTCTCCGCTCCTGATAATGCTCGAGCATTATCAGGAGCGGAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198719.1-1552s21c1
Sequence:CCGGTACCCATGGAGATCAACTTTACTCGAGTAAAGTTGATCTCCATGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198719.1-1374s21c1
Sequence:CCGGCTTGATGTGGAGCGACCATTTCTCGAGAAATGGTCGCTCCACATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198719.1-1467s21c1
Sequence:CCGGCCACCTGAGAAGGATAATTATCTCGAGATAATTATCCTTCTCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198719
PTGER3 MISSION shRNA Lentiviral Transduction Particles
prostaglandin E receptor 3 (subtype EP3)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000357982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198719.1-1114s21c1
Sequence:CCGGTGGTCTCCGCTCCTGATAATGCTCGAGCATTATCAGGAGCGGAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198719.1-1552s21c1
Sequence:CCGGTACCCATGGAGATCAACTTTACTCGAGTAAAGTTGATCTCCATGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198719.1-1374s21c1
Sequence:CCGGCTTGATGTGGAGCGACCATTTCTCGAGAAATGGTCGCTCCACATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358051    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198719.1-1467s21c1
Sequence:CCGGCCACCTGAGAAGGATAATTATCTCGAGATAATTATCCTTCTCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks