EMAIL THIS PAGE TO A FRIEND

PTGER4

prostaglandin E receptor 4 (subtype EP4)

Synonyms: EP4 EP4R
UniProtKB ID: P35408, Q3MJ87
Gene ID:
Human(5734) Summary: The protein encoded by this gene is a member of the G-protein coupled receptor family. This protein is one of four receptors identified for prostaglandin E2 (PGE2). This receptor can activate T-cell factor signaling. It has been shown to mediate PGE2 induced expression of early growth response 1 (EGR1), regulate the level and stability of cyclooxygenase-2 mRNA, and lead to the phosphorylation of glycogen synthase kinase-3. Knockout studies in mice suggest that this receptor may be involved in the neonatal adaptation of circulatory system, osteoporosis, as well as initiation of skin immune responses. [provided by RefSeq, Jul 2008]
Mouse(19219) prostaglandin E receptor 4 (subtype EP4)
Rat(84023) prostaglandin E receptor 4 (subtype EP4)
domestic guinea pig(100192398) prostaglandin E receptor 4 (subtype EP4)
Domestic Rabbit(100009081) prostaglandin E receptor 4 (subtype EP4)
naked mole-rat(101723705) prostaglandin E receptor 4 (subtype EP4)
cow(282331) prostaglandin E receptor 4 (subtype EP4)
sheep(101104343) prostaglandin E receptor 4 (subtype EP4)
sheep(443222) prostaglandin E receptor 4 (subtype EP4)
chicken(427183) prostaglandin E receptor 4 (subtype EP4)
domestic cat(101094734) prostaglandin E receptor 4 (subtype EP4)
domestic cat(100169968) prostaglandin E receptor 4 (subtype EP4)
dog(403589) prostaglandin E receptor 4 (subtype EP4)
120 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
P5640 Prostaglandin E2 ≥93% (HPLC), synthetic human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008965 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008965 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008965 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000958 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000958 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000958 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000958 Rosetta Predictions human pricing
NM_032076 Rosetta Predictions rat pricing
NM_008965 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000958 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105505 predicted 2142
2 SASI_Hs01_00105506 predicted 2075
3 SASI_Hs01_00105507 predicted 1585
4 SASI_Hs01_00105508 predicted 2149
5 SASI_Hs01_00105509 predicted 1691
6 SASI_Hs01_00105510 predicted 2116
7 SASI_Hs01_00105511 predicted 1455
8 SASI_Hs01_00105513 predicted 1882
9 SASI_Hs01_00105514 predicted 2157
10 SASI_Hs02_00303572 predicted 948
11 SASI_Hs01_00105512 predicted 1496
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032076 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037920 predicted 203
2 SASI_Rn02_00265440 predicted 1180
3 SASI_Rn01_00037924 predicted 1189
4 SASI_Rn01_00037925 predicted 1095
5 SASI_Rn02_00265441 predicted 252
6 SASI_Rn01_00037926 predicted 1016
7 SASI_Rn01_00037927 predicted 512
8 SASI_Rn02_00265442 predicted 882
9 SASI_Rn02_00265443 predicted 900
10 SASI_Rn01_00037929 predicted 222
11 SASI_Rn01_00037921 predicted 250
12 SASI_Rn01_00037922 predicted 443
13 SASI_Rn01_00037923 predicted 1364
14 SASI_Rn01_00037928 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008965 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062373 predicted 1088
2 SASI_Mm01_00062374 predicted 1113
3 SASI_Mm01_00062375 predicted 1224
4 SASI_Mm01_00062376 predicted 969
5 SASI_Mm01_00062377 predicted 252
6 SASI_Mm01_00062378 predicted 1489
7 SASI_Mm01_00062379 predicted 564
8 SASI_Mm01_00062381 predicted 1726
9 SASI_Mm01_00062382 predicted 571
10 SASI_Mm02_00315040 predicted 627
11 SASI_Mm01_00062380 predicted 378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008965
PTGER4 MISSION shRNA Bacterial Glycerol Stock
prostaglandin E receptor 4 (subtype EP4)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008965.1-1091s21c1
Sequence:CCGGGTGTTCATTAACCAGTTATATCTCGAGATATAACTGGTTAATGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008965.1-629s21c1
Sequence:CCGGTTCGCCATCTATGCATCTAACCTCGAGGTTAGATGCATAGATGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008965.1-2152s21c1
Sequence:CCGGGCCAATATAACCAGCTAATATCTCGAGATATTAGCTGGTTATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008965.1-313s21c1
Sequence:CCGGCCTGGTGGCCATCGTAGTATTCTCGAGAATACTACGATGGCCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008965.1-1498s21c1
Sequence:CCGGGCTGAGAACTTTGCGAATTTCCTCGAGGAAATTCGCAAAGTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008965.1-1193s1c1
Sequence:CCGGCCCTGGATTTACATCCTTCTTCTCGAGAAGAAGGATGTAAATCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008965.1-183s1c1
Sequence:CCGGGCTGTGTGTTACTAACCACCACTCGAGTGGTGGTTAGTAACACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008965.1-1638s1c1
Sequence:CCGGCCAGTGAAACTCTGAAATTATCTCGAGATAATTTCAGAGTTTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008965.1-1088s1c1
Sequence:CCGGCGAGTGTTCATTAACCAGTTACTCGAGTAACTGGTTAATGAACACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008965.1-1497s1c1
Sequence:CCGGCGCTGAGAACTTTGCGAATTTCTCGAGAAATTCGCAAAGTTCTCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008965
PTGER4 MISSION shRNA shRNA Plasmid DNA
prostaglandin E receptor 4 (subtype EP4)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008965.1-1091s21c1
Sequence:CCGGGTGTTCATTAACCAGTTATATCTCGAGATATAACTGGTTAATGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008965.1-629s21c1
Sequence:CCGGTTCGCCATCTATGCATCTAACCTCGAGGTTAGATGCATAGATGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008965.1-2152s21c1
Sequence:CCGGGCCAATATAACCAGCTAATATCTCGAGATATTAGCTGGTTATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008965.1-313s21c1
Sequence:CCGGCCTGGTGGCCATCGTAGTATTCTCGAGAATACTACGATGGCCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008965.1-1498s21c1
Sequence:CCGGGCTGAGAACTTTGCGAATTTCCTCGAGGAAATTCGCAAAGTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008965.1-1193s1c1
Sequence:CCGGCCCTGGATTTACATCCTTCTTCTCGAGAAGAAGGATGTAAATCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008965.1-183s1c1
Sequence:CCGGGCTGTGTGTTACTAACCACCACTCGAGTGGTGGTTAGTAACACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008965.1-1638s1c1
Sequence:CCGGCCAGTGAAACTCTGAAATTATCTCGAGATAATTTCAGAGTTTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008965.1-1088s1c1
Sequence:CCGGCGAGTGTTCATTAACCAGTTACTCGAGTAACTGGTTAATGAACACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008965.1-1497s1c1
Sequence:CCGGCGCTGAGAACTTTGCGAATTTCTCGAGAAATTCGCAAAGTTCTCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008965
PTGER4 MISSION shRNA Lentiviral Transduction Particles
prostaglandin E receptor 4 (subtype EP4)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008965.1-1091s21c1
Sequence:CCGGGTGTTCATTAACCAGTTATATCTCGAGATATAACTGGTTAATGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008965.1-629s21c1
Sequence:CCGGTTCGCCATCTATGCATCTAACCTCGAGGTTAGATGCATAGATGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329394    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008965.1-2152s21c1
Sequence:CCGGGCCAATATAACCAGCTAATATCTCGAGATATTAGCTGGTTATATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008965.1-313s21c1
Sequence:CCGGCCTGGTGGCCATCGTAGTATTCTCGAGAATACTACGATGGCCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008965.1-1498s21c1
Sequence:CCGGGCTGAGAACTTTGCGAATTTCCTCGAGGAAATTCGCAAAGTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008965.1-1193s1c1
Sequence:CCGGCCCTGGATTTACATCCTTCTTCTCGAGAAGAAGGATGTAAATCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008965.1-183s1c1
Sequence:CCGGGCTGTGTGTTACTAACCACCACTCGAGTGGTGGTTAGTAACACACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008965.1-1638s1c1
Sequence:CCGGCCAGTGAAACTCTGAAATTATCTCGAGATAATTTCAGAGTTTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008965.1-1088s1c1
Sequence:CCGGCGAGTGTTCATTAACCAGTTACTCGAGTAACTGGTTAATGAACACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008965.1-1497s1c1
Sequence:CCGGCGCTGAGAACTTTGCGAATTTCTCGAGAAATTCGCAAAGTTCTCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000958
VALIDATED
PTGER4 MISSION shRNA Bacterial Glycerol Stock
prostaglandin E receptor 4 (subtype EP4)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000226399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000958.2-1466s21c1
Sequence:CCGGGTATTCGTCAACCAGTTATATCTCGAGATATAACTGGTTGACGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000958.2-1882s21c1
Sequence:CCGGACTGAGGACTTTGCGAATATCCTCGAGGATATTCGCAAAGTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000958.2-2369s21c1
Sequence:GTACCGGATCCAGAGCTTTGTCGTATTTCTCGAGAAATACGACAAAGCTCTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000958.2-1398s21c1
Sequence:GTACCGGAGATGGTCATCTTACTCATTGCTCGAGCAATGAGTAAGATGACCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000958.2-1496s21c1
Sequence:CCGGTTGGAGCGAGAAGTCAGTAAACTCGAGTTTACTGACTTCTCGCTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000204    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_000958.x-1876s1c1
Sequence:CCGGGTACTGTTTCTGGACCCTTATCTCGAGATAAGGGTCCAGAAACAGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_000958.x-1272s1c1
Sequence:CCGGACCAGTTATATCAGCCAAGTTCTCGAGAACTTGGCTGATATAACTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000958.x-1273s1c1
Sequence:CCGGCCAGTTATATCAGCCAAGTTTCTCGAGAAACTTGGCTGATATAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000958.x-1399s1c1
Sequence:CCGGCAGTAAAGCAATAGAGAAGATCTCGAGATCTTCTCTATTGCTTTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_000958.x-800s1c1
Sequence:CCGGCTCACGCTCTTTGCAGTCTATCTCGAGATAGACTGCAAAGAGCGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000958
VALIDATED
PTGER4 MISSION shRNA shRNA Plasmid DNA
prostaglandin E receptor 4 (subtype EP4)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000226399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000958.2-1466s21c1
Sequence:CCGGGTATTCGTCAACCAGTTATATCTCGAGATATAACTGGTTGACGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000958.2-1882s21c1
Sequence:CCGGACTGAGGACTTTGCGAATATCCTCGAGGATATTCGCAAAGTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000958.2-2369s21c1
Sequence:GTACCGGATCCAGAGCTTTGTCGTATTTCTCGAGAAATACGACAAAGCTCTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000958.2-1398s21c1
Sequence:GTACCGGAGATGGTCATCTTACTCATTGCTCGAGCAATGAGTAAGATGACCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000958.2-1496s21c1
Sequence:CCGGTTGGAGCGAGAAGTCAGTAAACTCGAGTTTACTGACTTCTCGCTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000204    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_000958.x-1876s1c1
Sequence:CCGGGTACTGTTTCTGGACCCTTATCTCGAGATAAGGGTCCAGAAACAGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_000958.x-1272s1c1
Sequence:CCGGACCAGTTATATCAGCCAAGTTCTCGAGAACTTGGCTGATATAACTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000958.x-1273s1c1
Sequence:CCGGCCAGTTATATCAGCCAAGTTTCTCGAGAAACTTGGCTGATATAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000958.x-1399s1c1
Sequence:CCGGCAGTAAAGCAATAGAGAAGATCTCGAGATCTTCTCTATTGCTTTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_000958.x-800s1c1
Sequence:CCGGCTCACGCTCTTTGCAGTCTATCTCGAGATAGACTGCAAAGAGCGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000958
VALIDATED
PTGER4 MISSION shRNA Lentiviral Transduction Particles
prostaglandin E receptor 4 (subtype EP4)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000226399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000958.2-1466s21c1
Sequence:CCGGGTATTCGTCAACCAGTTATATCTCGAGATATAACTGGTTGACGAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000958.2-1882s21c1
Sequence:CCGGACTGAGGACTTTGCGAATATCCTCGAGGATATTCGCAAAGTCCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000958.2-2369s21c1
Sequence:GTACCGGATCCAGAGCTTTGTCGTATTTCTCGAGAAATACGACAAAGCTCTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000958.2-1398s21c1
Sequence:GTACCGGAGATGGTCATCTTACTCATTGCTCGAGCAATGAGTAAGATGACCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000958.2-1496s21c1
Sequence:CCGGTTGGAGCGAGAAGTCAGTAAACTCGAGTTTACTGACTTCTCGCTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000204    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_000958.x-1876s1c1
Sequence:CCGGGTACTGTTTCTGGACCCTTATCTCGAGATAAGGGTCCAGAAACAGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_000958.x-1272s1c1
Sequence:CCGGACCAGTTATATCAGCCAAGTTCTCGAGAACTTGGCTGATATAACTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000958.x-1273s1c1
Sequence:CCGGCCAGTTATATCAGCCAAGTTTCTCGAGAAACTTGGCTGATATAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000958.x-1399s1c1
Sequence:CCGGCAGTAAAGCAATAGAGAAGATCTCGAGATCTTCTCTATTGCTTTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_000958.x-800s1c1
Sequence:CCGGCTCACGCTCTTTGCAGTCTATCTCGAGATAGACTGCAAAGAGCGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks