EMAIL THIS PAGE TO A FRIEND

PTGFRN

prostaglandin F2 receptor inhibitor

Synonyms: CD315 CD9P-1 EWI-F FPRP SMAP-6
UniProtKB ID: Q9P2B2, Q5VVU9, Q8N2K6
Gene ID:
Mouse(19221) prostaglandin F2 receptor negative regulator
Rat(29602) prostaglandin F2 receptor inhibitor
cow(538209) prostaglandin F2 receptor inhibitor
sheep(101111151) prostaglandin F2 receptor negative regulator
naked mole-rat(101719857) prostaglandin F2 receptor inhibitor
Domestic Rabbit(100348494) prostaglandin F2 receptor negative regulator
domestic guinea pig(100735603) prostaglandin F2 receptor inhibitor
chicken(418449) prostaglandin F2 receptor negative regulator
dog(475809) prostaglandin F2 receptor negative regulator
Horse(100146680) prostaglandin F2 receptor negative regulator
domestic cat(101085393) prostaglandin F2 receptor negative regulator
172 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020440 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020440 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020440 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011197 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011197 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011197 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020440 Rosetta Predictions human pricing
NM_019243 Rosetta Predictions rat pricing
NM_011197 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167556 predicted 1937
2 SASI_Hs01_00167557 predicted 1456
3 SASI_Hs01_00167558 predicted 1200
4 SASI_Hs01_00167559 predicted 1027
5 SASI_Hs01_00167561 predicted 1346
6 SASI_Hs01_00167562 predicted 1829
7 SASI_Hs02_00353462 predicted 407
8 SASI_Hs01_00167564 predicted 2312
9 SASI_Hs02_00353463 predicted 1840
10 SASI_Hs02_00353464 predicted 1811
11 SASI_Hs01_00167560 predicted 1169
12 SASI_Hs01_00167563 predicted 2174
13 SASI_Hs01_00167565 predicted 1489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019243 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114858 predicted 2148
2 SASI_Rn01_00114859 predicted 1740
3 SASI_Rn01_00114860 predicted 1656
4 SASI_Rn01_00114861 predicted 1522
5 SASI_Rn01_00114862 predicted 1570
6 SASI_Rn01_00114863 predicted 545
7 SASI_Rn01_00114864 predicted 533
8 SASI_Rn01_00114865 predicted 2079
9 SASI_Rn01_00114866 predicted 2218
10 SASI_Rn01_00114867 predicted 1256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011197 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083155 predicted 1775
2 SASI_Mm02_00320111 predicted 2381
3 SASI_Mm01_00083156 predicted 1730
4 SASI_Mm01_00083157 predicted 1714
5 SASI_Mm01_00083158 predicted 2051
6 SASI_Mm01_00083160 predicted 1554
7 SASI_Mm01_00083161 predicted 1125
8 SASI_Mm02_00320112 predicted 2082
9 SASI_Mm01_00083162 predicted 1614
10 SASI_Mm01_00083163 predicted 2207
11 SASI_Mm01_00083159 predicted 2143
12 SASI_Mm01_00083164 predicted 2662
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020440
VALIDATED
PTGFRN MISSION shRNA Bacterial Glycerol Stock
prostaglandin F2 receptor inhibitor
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020440.2-2313s1c1
Sequence:CCGGGCCTTTGATGTGTCCTGGTTTCTCGAGAAACCAGGACACATCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_020440.2-2492s1c1
Sequence:CCGGCCAGGACTTTGGCAACTACTACTCGAGTAGTAGTTGCCAAAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_020440.2-1767s1c1
Sequence:CCGGGCATTAGAAGATTCCGTGCTTCTCGAGAAGCACGGAATCTTCTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_020440.2-2169s1c1
Sequence:CCGGCCTATTGAGATAGACTTCCAACTCGAGTTGGAAGTCTATCTCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020440.2-1197s1c1
Sequence:CCGGCGCTCCTACCATTTACTGGTTCTCGAGAACCAGTAAATGGTAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020440
VALIDATED
PTGFRN MISSION shRNA shRNA Plasmid DNA
prostaglandin F2 receptor inhibitor
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020440.2-2313s1c1
Sequence:CCGGGCCTTTGATGTGTCCTGGTTTCTCGAGAAACCAGGACACATCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_020440.2-2492s1c1
Sequence:CCGGCCAGGACTTTGGCAACTACTACTCGAGTAGTAGTTGCCAAAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_020440.2-1767s1c1
Sequence:CCGGGCATTAGAAGATTCCGTGCTTCTCGAGAAGCACGGAATCTTCTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_020440.2-2169s1c1
Sequence:CCGGCCTATTGAGATAGACTTCCAACTCGAGTTGGAAGTCTATCTCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020440.2-1197s1c1
Sequence:CCGGCGCTCCTACCATTTACTGGTTCTCGAGAACCAGTAAATGGTAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020440
VALIDATED
PTGFRN MISSION shRNA Lentiviral Transduction Particles
prostaglandin F2 receptor inhibitor
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020440.2-2313s1c1
Sequence:CCGGGCCTTTGATGTGTCCTGGTTTCTCGAGAAACCAGGACACATCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_020440.2-2492s1c1
Sequence:CCGGCCAGGACTTTGGCAACTACTACTCGAGTAGTAGTTGCCAAAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_020440.2-1767s1c1
Sequence:CCGGGCATTAGAAGATTCCGTGCTTCTCGAGAAGCACGGAATCTTCTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_020440.2-2169s1c1
Sequence:CCGGCCTATTGAGATAGACTTCCAACTCGAGTTGGAAGTCTATCTCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020440.2-1197s1c1
Sequence:CCGGCGCTCCTACCATTTACTGGTTCTCGAGAACCAGTAAATGGTAGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011197
PTGFRN MISSION shRNA Bacterial Glycerol Stock
prostaglandin F2 receptor inhibitor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011197.2-2202s1c1
Sequence:CCGGGCCTTCGATGTATCCTGGTTTCTCGAGAAACCAGGATACATCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011197.2-908s1c1
Sequence:CCGGCCTGGATCTTTCTTGCAACATCTCGAGATGTTGCAAGAAAGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011197.2-1766s1c1
Sequence:CCGGGCCACGATACTCAGTTCTCATCTCGAGATGAGAACTGAGTATCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011197.2-5070s1c1
Sequence:CCGGCCGCTGAAAGAACCTAAGCTACTCGAGTAGCTTAGGTTCTTTCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011197.2-1505s1c1
Sequence:CCGGGCACACAGACACATTCAATTTCTCGAGAAATTGAATGTGTCTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011197
PTGFRN MISSION shRNA shRNA Plasmid DNA
prostaglandin F2 receptor inhibitor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011197.2-2202s1c1
Sequence:CCGGGCCTTCGATGTATCCTGGTTTCTCGAGAAACCAGGATACATCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011197.2-908s1c1
Sequence:CCGGCCTGGATCTTTCTTGCAACATCTCGAGATGTTGCAAGAAAGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011197.2-1766s1c1
Sequence:CCGGGCCACGATACTCAGTTCTCATCTCGAGATGAGAACTGAGTATCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011197.2-5070s1c1
Sequence:CCGGCCGCTGAAAGAACCTAAGCTACTCGAGTAGCTTAGGTTCTTTCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011197.2-1505s1c1
Sequence:CCGGGCACACAGACACATTCAATTTCTCGAGAAATTGAATGTGTCTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011197
PTGFRN MISSION shRNA Lentiviral Transduction Particles
prostaglandin F2 receptor inhibitor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011197.2-2202s1c1
Sequence:CCGGGCCTTCGATGTATCCTGGTTTCTCGAGAAACCAGGATACATCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011197.2-908s1c1
Sequence:CCGGCCTGGATCTTTCTTGCAACATCTCGAGATGTTGCAAGAAAGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011197.2-1766s1c1
Sequence:CCGGGCCACGATACTCAGTTCTCATCTCGAGATGAGAACTGAGTATCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011197.2-5070s1c1
Sequence:CCGGCCGCTGAAAGAACCTAAGCTACTCGAGTAGCTTAGGTTCTTTCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011197.2-1505s1c1
Sequence:CCGGGCACACAGACACATTCAATTTCTCGAGAAATTGAATGTGTCTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks