EMAIL THIS PAGE TO A FRIEND

PTGR1

prostaglandin reductase 1

Synonyms: LTB4DH PGR1 ZADH3
UniProtKB ID: Q14914, A8K0N2, B4DPK3, F5GY50, Q8IYQ0, Q9H1X6
Gene ID:
Human(22949) Summary: This gene encodes an enzyme that is involved in the inactivation of the chemotactic factor, leukotriene B4. The encoded protein specifically catalyzes the NADP+ dependent conversion of leukotriene B4 to 12-oxo-leukotriene B4. A pseudogene of this gene is found on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
Mouse(67103) prostaglandin reductase 1
Rat(192227) prostaglandin reductase 1
Zebrafish(494108) prostaglandin reductase 1
chicken(427337) prostaglandin reductase 1
dog(474802) prostaglandin reductase 1
domestic cat(101093468) prostaglandin reductase 1
domestic guinea pig(100135572) prostaglandin reductase 1
naked mole-rat(101699930) prostaglandin reductase 1
Domestic Rabbit(100009440) prostaglandin reductase 1
cow(513177) prostaglandin reductase 1
sheep(101112113) prostaglandin reductase 1
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025968 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025968 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025968 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012212 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012212 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012212 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012212 Rosetta Predictions human pricing
NM_138863 Rosetta Predictions rat pricing
NM_025968 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012212 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034814 predicted 999
2 SASI_Hs01_00034815 predicted 773
3 SASI_Hs02_00343875 predicted 384
4 SASI_Hs01_00034816 predicted 658
5 SASI_Hs01_00034817 predicted 489
6 SASI_Hs01_00034818 predicted 524
7 SASI_Hs02_00343876 predicted 382
8 SASI_Hs01_00034821 predicted 769
9 SASI_Hs01_00034822 predicted 778
10 SASI_Hs01_00034823 predicted 602
11 SASI_Hs01_00034819 predicted 989
12 SASI_Hs01_00034820 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138863 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268270 predicted 600
2 SASI_Rn02_00268271 predicted 737
3 SASI_Rn01_00065705 predicted 456
4 SASI_Rn01_00065706 predicted 413
5 SASI_Rn01_00065707 predicted 718
6 SASI_Rn01_00065708 predicted 307
7 SASI_Rn01_00065709 predicted 293
8 SASI_Rn01_00065710 predicted 212
9 SASI_Rn01_00065711 predicted 295
10 SASI_Rn01_00065712 predicted 222
11 SASI_Rn01_00065713 predicted 806
12 SASI_Rn01_00065714 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025968 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066984 predicted 298
2 SASI_Mm01_00066985 predicted 431
3 SASI_Mm01_00066986 predicted 604
4 SASI_Mm01_00066987 predicted 294
5 SASI_Mm01_00066988 predicted 1510
6 SASI_Mm01_00066989 predicted 1537
7 SASI_Mm01_00066990 predicted 364
8 SASI_Mm01_00066991 predicted 901
9 SASI_Mm01_00066992 predicted 673
10 SASI_Mm01_00066993 predicted 738
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025968
VALIDATED
PTGR1 MISSION shRNA Bacterial Glycerol Stock
prostaglandin reductase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025968.2-309s1c1
Sequence:CCGGCGGCTTTATTAGGTTGGACATCTCGAGATGTCCAACCTAATAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025968.2-982s1c1
Sequence:CCGGCGCAGCATTTATGGGAATGTTCTCGAGAACATTCCCATAAATGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025968.2-674s1c1
Sequence:CCGGCCCGATGGTTATGATTGCTATCTCGAGATAGCAATCATAACCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025968.2-257s1c1
Sequence:CCGGGCCAGAGTCGTGGAAAGTAAACTCGAGTTTACTTTCCACGACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025968.2-724s1c1
Sequence:CCGGCGCTGTTATACTCCAGATGAACTCGAGTTCATCTGGAGTATAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025968.3-981s21c1
Sequence:CCGGCGCAGCATTTATGGGAATGTTCTCGAGAACATTCCCATAAATGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025968.3-308s21c1
Sequence:CCGGCGGCTTTATTAGGTTGGACATCTCGAGATGTCCAACCTAATAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025968.3-673s21c1
Sequence:CCGGCCCGATGGTTATGATTGCTATCTCGAGATAGCAATCATAACCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025968.3-256s21c1
Sequence:CCGGGCCAGAGTCGTGGAAAGTAAACTCGAGTTTACTTTCCACGACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025968.3-723s21c1
Sequence:CCGGCGCTGTTATACTCCAGATGAACTCGAGTTCATCTGGAGTATAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025968
VALIDATED
PTGR1 MISSION shRNA shRNA Plasmid DNA
prostaglandin reductase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025968.2-309s1c1
Sequence:CCGGCGGCTTTATTAGGTTGGACATCTCGAGATGTCCAACCTAATAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025968.2-982s1c1
Sequence:CCGGCGCAGCATTTATGGGAATGTTCTCGAGAACATTCCCATAAATGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025968.2-674s1c1
Sequence:CCGGCCCGATGGTTATGATTGCTATCTCGAGATAGCAATCATAACCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025968.2-257s1c1
Sequence:CCGGGCCAGAGTCGTGGAAAGTAAACTCGAGTTTACTTTCCACGACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025968.2-724s1c1
Sequence:CCGGCGCTGTTATACTCCAGATGAACTCGAGTTCATCTGGAGTATAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025968.3-981s21c1
Sequence:CCGGCGCAGCATTTATGGGAATGTTCTCGAGAACATTCCCATAAATGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025968.3-308s21c1
Sequence:CCGGCGGCTTTATTAGGTTGGACATCTCGAGATGTCCAACCTAATAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025968.3-673s21c1
Sequence:CCGGCCCGATGGTTATGATTGCTATCTCGAGATAGCAATCATAACCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025968.3-256s21c1
Sequence:CCGGGCCAGAGTCGTGGAAAGTAAACTCGAGTTTACTTTCCACGACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025968.3-723s21c1
Sequence:CCGGCGCTGTTATACTCCAGATGAACTCGAGTTCATCTGGAGTATAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025968
VALIDATED
PTGR1 MISSION shRNA Lentiviral Transduction Particles
prostaglandin reductase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025968.2-309s1c1
Sequence:CCGGCGGCTTTATTAGGTTGGACATCTCGAGATGTCCAACCTAATAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025968.2-982s1c1
Sequence:CCGGCGCAGCATTTATGGGAATGTTCTCGAGAACATTCCCATAAATGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025968.2-674s1c1
Sequence:CCGGCCCGATGGTTATGATTGCTATCTCGAGATAGCAATCATAACCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025968.2-257s1c1
Sequence:CCGGGCCAGAGTCGTGGAAAGTAAACTCGAGTTTACTTTCCACGACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025968.2-724s1c1
Sequence:CCGGCGCTGTTATACTCCAGATGAACTCGAGTTCATCTGGAGTATAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025968.3-981s21c1
Sequence:CCGGCGCAGCATTTATGGGAATGTTCTCGAGAACATTCCCATAAATGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025968.3-308s21c1
Sequence:CCGGCGGCTTTATTAGGTTGGACATCTCGAGATGTCCAACCTAATAAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025968.3-673s21c1
Sequence:CCGGCCCGATGGTTATGATTGCTATCTCGAGATAGCAATCATAACCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025968.3-256s21c1
Sequence:CCGGGCCAGAGTCGTGGAAAGTAAACTCGAGTTTACTTTCCACGACTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025968.3-723s21c1
Sequence:CCGGCGCTGTTATACTCCAGATGAACTCGAGTTCATCTGGAGTATAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012212
PTGR1 MISSION shRNA Bacterial Glycerol Stock
prostaglandin reductase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012212.2-959s1c1
Sequence:CCGGGACTTGCTGAAATGGGTCTTACTCGAGTAAGACCCATTTCAGCAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012212.2-720s1c1
Sequence:CCGGCGTCTCCTGATGGTTATGATTCTCGAGAATCATAACCATCAGGAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012212.2-656s1c1
Sequence:CCGGCTTGGATTTGATGTCGTCTTTCTCGAGAAAGACGACATCAAATCCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012212.2-488s1c1
Sequence:CCGGGCCTACTTTGGCCTACTTGAACTCGAGTTCAAGTAGGCCAAAGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012212.2-148s1c1
Sequence:CCGGCTATCCTACTAATAGTGACTTCTCGAGAAGTCACTATTAGTAGGATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012212.3-488s21c1
Sequence:CCGGGCCTACTTTGGCCTACTTGAACTCGAGTTCAAGTAGGCCAAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012212.3-959s21c1
Sequence:CCGGGACTTGCTGAAATGGGTCTTACTCGAGTAAGACCCATTTCAGCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012212.3-720s21c1
Sequence:CCGGCGTCTCCTGATGGTTATGATTCTCGAGAATCATAACCATCAGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012212.3-656s21c1
Sequence:CCGGCTTGGATTTGATGTCGTCTTTCTCGAGAAAGACGACATCAAATCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012212
PTGR1 MISSION shRNA shRNA Plasmid DNA
prostaglandin reductase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012212.2-959s1c1
Sequence:CCGGGACTTGCTGAAATGGGTCTTACTCGAGTAAGACCCATTTCAGCAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012212.2-720s1c1
Sequence:CCGGCGTCTCCTGATGGTTATGATTCTCGAGAATCATAACCATCAGGAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012212.2-656s1c1
Sequence:CCGGCTTGGATTTGATGTCGTCTTTCTCGAGAAAGACGACATCAAATCCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012212.2-488s1c1
Sequence:CCGGGCCTACTTTGGCCTACTTGAACTCGAGTTCAAGTAGGCCAAAGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012212.2-148s1c1
Sequence:CCGGCTATCCTACTAATAGTGACTTCTCGAGAAGTCACTATTAGTAGGATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012212.3-488s21c1
Sequence:CCGGGCCTACTTTGGCCTACTTGAACTCGAGTTCAAGTAGGCCAAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012212.3-959s21c1
Sequence:CCGGGACTTGCTGAAATGGGTCTTACTCGAGTAAGACCCATTTCAGCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012212.3-720s21c1
Sequence:CCGGCGTCTCCTGATGGTTATGATTCTCGAGAATCATAACCATCAGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012212.3-656s21c1
Sequence:CCGGCTTGGATTTGATGTCGTCTTTCTCGAGAAAGACGACATCAAATCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012212
PTGR1 MISSION shRNA Lentiviral Transduction Particles
prostaglandin reductase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012212.2-959s1c1
Sequence:CCGGGACTTGCTGAAATGGGTCTTACTCGAGTAAGACCCATTTCAGCAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012212.2-720s1c1
Sequence:CCGGCGTCTCCTGATGGTTATGATTCTCGAGAATCATAACCATCAGGAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012212.2-656s1c1
Sequence:CCGGCTTGGATTTGATGTCGTCTTTCTCGAGAAAGACGACATCAAATCCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012212.2-488s1c1
Sequence:CCGGGCCTACTTTGGCCTACTTGAACTCGAGTTCAAGTAGGCCAAAGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012212.2-148s1c1
Sequence:CCGGCTATCCTACTAATAGTGACTTCTCGAGAAGTCACTATTAGTAGGATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012212.3-488s21c1
Sequence:CCGGGCCTACTTTGGCCTACTTGAACTCGAGTTCAAGTAGGCCAAAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012212.3-959s21c1
Sequence:CCGGGACTTGCTGAAATGGGTCTTACTCGAGTAAGACCCATTTCAGCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012212.3-720s21c1
Sequence:CCGGCGTCTCCTGATGGTTATGATTCTCGAGAATCATAACCATCAGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012212.3-656s21c1
Sequence:CCGGCTTGGATTTGATGTCGTCTTTCTCGAGAAAGACGACATCAAATCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks