EMAIL THIS PAGE TO A FRIEND

PTGS2

prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)

Synonyms: COX-2 COX2 GRIPGHS PGG/HS PGHS-2 PHS-2 hCox-2
UniProtKB ID: P35354, A8K802, Q16876
Gene ID:
Human(5743) Summary: Prostaglandin-endoperoxide synthase (PTGS), also known as cyclooxygenase, is the key enzyme in prostaglandin biosynthesis, and acts both as a dioxygenase and as a peroxidase. There are two isozymes of PTGS: a constitutive PTGS1 and an inducible PTGS2, which differ in their regulation of expression and tissue distribution. This gene encodes the inducible isozyme. It is regulated by specific stimulatory events, suggesting that it is responsible for the prostanoid biosynthesis involved in inflammation and mitogenesis. [provided by RefSeq, Feb 2009]
Mouse(19225) prostaglandin-endoperoxide synthase 2
Rat(29527) prostaglandin-endoperoxide synthase 2
cow(282023) prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
sheep(443460) prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
Goat(100860905) prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
naked mole-rat(101704771) prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
Domestic Rabbit(100009248) prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
domestic guinea pig(100135607) prostaglandin-endoperoxide synthase 2
chicken(396451) prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
Horse(791253) prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
domestic cat(100126581) prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
dog(442942) prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
158 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4200577 Anti-COX2 (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human, mouse
immunofluorescence, western blot pricing
HPA001335 Anti-COX2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4200576 Anti-COX2 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human, mouse
immunofluorescence, western blot pricing
SAB5500087 Anti-COX2 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP21, tissue culture supernatant human (tested)
immunohistochemistry pricing
SAB4502491 Anti-COX2, C-Terminal antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB2500267 Anti-COX2/PTGS2 antibody produced in goat affinity isolated antibody, buffered aqueous solution pig, sheep, human, bovine, canine
ELISA, western blot pricing
SAB1406338 Anti-PTGS2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1408624 Anti-PTGS2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
C9354 Monoclonal Anti-COX II antibody produced in mouse clone AS66, purified immunoglobulin, buffered aqueous solution human
ELISA, flow cytometry, microarray, western blot pricing

Small Molecule - Blocker

Product # Description Species Add to Cart
 
T4376 N-p-Tosyl-L-phenylalanine chloromethyl ketone ≥97% (TLC), powder human pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A5376 Acetylsalicylic acid ≥99.0% human pricing
A3160 Acetylsalicylic acid analytical standard human pricing
A6810 Acetylsalicylic acid BioReagent, plant cell culture tested, ≥99.0% human pricing
A2093 Aspirin meets USP testing specifications human pricing
D0879 Diisopropylfluorophosphate human pricing
38399 Diisopropylfluorophosphate ≥97.0% (GC) human pricing
E0516 Etodolac human pricing
I1762 Isoxicam analytical standard human pricing
K1751 Ketoprofen ≥98% (TLC) human pricing
K2012 Ketoprofen meets USP testing specifications human pricing
34016 Ketoprofen VETRANAL, analytical standard human pricing
L0664 Loxoprofen solid human pricing
N6142 Nabumetone analytical standard human pricing
M1275 Naproxen sodium 98.0-102.0% human pricing
N1016 Nimesulide human pricing
P8386 Phenylbutazone human pricing
S2064 SC-560 ≥98% (HPLC) human pricing
S8139 Sulindac ≥98.0% human pricing
T6376 Triamcinolone human pricing
471909 (S)-(+)-Ketoprofen 99% human, mouse pricing
N5023 Nordihydroguaiaretic acid ≥90% (HPLC), from Larrea divaricata (creosote bush) human, mouse pricing
N194 NS-398 ≥98% (HPLC), solid human, mouse pricing
C80105 Chrysin 97% human, mouse, rat pricing
D1756 Dexamethasone ≥98% (HPLC), powder human, mouse, rat pricing
D4902 Dexamethasone powder, BioReagent, suitable for cell culture, ≥97% human, mouse, rat pricing
D8893 Dexamethasone powder, γ-irradiated, BioXtra, suitable for cell culture, ≥80% (HPLC) human, mouse, rat pricing
D9184 Dexamethasone meets USP testing specifications human, mouse, rat pricing
46165 Dexamethasone VETRANAL, analytical standard human, mouse, rat pricing
31375 Dexamethasone tested according to Ph.Eur. human, mouse, rat pricing
I4883 Ibuprofen ≥98% (GC) human, mouse, rat pricing
I7905 Ibuprofen meets USP testing specifications human, mouse, rat pricing
I7378 Indomethacin ≥99% (TLC) human, mouse, rat pricing
I8280 Indomethacin meets USP testing specifications human, mouse, rat pricing
284785 (S)-(+)-6-Methoxy-α-methyl-2-naphthaleneacetic acid 98% human, rat pricing
N8280 Naproxen meets USP testing specifications human, rat pricing
46482 Naproxen VETRANAL, analytical standard human, rat pricing
P5654 Piroxicam ≥98% (TLC) human, rat pricing
P0847 Piroxicam meets USP testing specifications human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000963 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000963 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000963 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011198 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011198 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011198 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000963 Rosetta Predictions human pricing
NM_017232 Rosetta Predictions rat pricing
NM_011198 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000963 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152843 predicted 1014
2 SASI_Hs01_00152844 predicted 246
3 SASI_Hs01_00152845 predicted 1217
4 SASI_Hs01_00152847 predicted 1353
5 SASI_Hs01_00152848 predicted 1107
6 SASI_Hs01_00152849 predicted 789
7 SASI_Hs01_00152850 predicted 989
8 SASI_Hs01_00152851 predicted 334
9 SASI_Hs01_00152852 predicted 256
10 SASI_Hs02_00303578 predicted 1142
11 SASI_Hs01_00152846 predicted 1065
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017232 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261598 predicted 1009
2 SASI_Rn02_00261599 predicted 1334
3 SASI_Rn01_00047564 predicted 1149
4 SASI_Rn01_00047565 predicted 370
5 SASI_Rn01_00047566 predicted 1224
6 SASI_Rn01_00047569 predicted 986
7 SASI_Rn01_00047570 predicted 245
8 SASI_Rn01_00047572 predicted 873
9 SASI_Rn02_00261600 predicted 1544
10 SASI_Rn02_00261601 predicted 1213
11 SASI_Rn01_00047563 predicted 1016
12 SASI_Rn01_00047567 predicted 788
13 SASI_Rn01_00047568 predicted 1138
14 SASI_Rn01_00047571 predicted 218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011198 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320113 predicted 1439
2 SASI_Mm01_00033731 predicted 734
3 SASI_Mm01_00033732 predicted 1647
4 SASI_Mm01_00033733 predicted 1073
5 SASI_Mm01_00033734 predicted 1082
6 SASI_Mm01_00033735 predicted 210
7 SASI_Mm01_00033736 predicted 1647
8 SASI_Mm01_00033737 predicted 1542
9 SASI_Mm01_00033738 predicted 1315
10 SASI_Mm02_00320114 predicted 353
11 SASI_Mm01_00033730 predicted 1440
12 SASI_Mm01_00033739 predicted 557
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000963
VALIDATED
PTGS2 MISSION shRNA Bacterial Glycerol Stock
prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1157s21c1
Sequence:CCGGCTATCACTTCAAACTGAAATTCTCGAGAATTTCAGTTTGAAGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1026s21c1
Sequence:CCGGAGAGTATGCGATGTGCTTAAACTCGAGTTTAAGCACATCGCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1677s21c1
Sequence:CCGGCCATTCTCCTTGAAAGGACTTCTCGAGAAGTCCTTTCAAGGAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1230s21c1
Sequence:CCGGGCTGAATTTAACACCCTCTATCTCGAGATAGAGGGTGTTAAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1487s21c1
Sequence:CCGGTGAGTACCGCAAACGCTTTATCTCGAGATAAAGCGTTTGCGGTACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000963.1-1227s1c1
Sequence:CCGGGCTGAATTTAACACCCTCTATCTCGAGATAGAGGGTGTTAAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000963.1-1460s1c1
Sequence:CCGGGCAGATGAAATACCAGTCTTTCTCGAGAAAGACTGGTATTTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000963.1-665s1c1
Sequence:CCGGCCAGGGCTCAAACATGATGTTCTCGAGAACATCATGTTTGAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000963.1-1674s1c1
Sequence:CCGGCCATTCTCCTTGAAAGGACTTCTCGAGAAGTCCTTTCAAGGAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000963.1-392s1c1
Sequence:CCGGCGTTGTGAATAACATTCCCTTCTCGAGAAGGGAATGTTATTCACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000963
VALIDATED
PTGS2 MISSION shRNA shRNA Plasmid DNA
prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1157s21c1
Sequence:CCGGCTATCACTTCAAACTGAAATTCTCGAGAATTTCAGTTTGAAGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1026s21c1
Sequence:CCGGAGAGTATGCGATGTGCTTAAACTCGAGTTTAAGCACATCGCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1677s21c1
Sequence:CCGGCCATTCTCCTTGAAAGGACTTCTCGAGAAGTCCTTTCAAGGAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1230s21c1
Sequence:CCGGGCTGAATTTAACACCCTCTATCTCGAGATAGAGGGTGTTAAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1487s21c1
Sequence:CCGGTGAGTACCGCAAACGCTTTATCTCGAGATAAAGCGTTTGCGGTACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000963.1-1227s1c1
Sequence:CCGGGCTGAATTTAACACCCTCTATCTCGAGATAGAGGGTGTTAAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000963.1-1460s1c1
Sequence:CCGGGCAGATGAAATACCAGTCTTTCTCGAGAAAGACTGGTATTTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000963.1-665s1c1
Sequence:CCGGCCAGGGCTCAAACATGATGTTCTCGAGAACATCATGTTTGAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000963.1-1674s1c1
Sequence:CCGGCCATTCTCCTTGAAAGGACTTCTCGAGAAGTCCTTTCAAGGAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000963.1-392s1c1
Sequence:CCGGCGTTGTGAATAACATTCCCTTCTCGAGAAGGGAATGTTATTCACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000963
VALIDATED
PTGS2 MISSION shRNA Lentiviral Transduction Particles
prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1157s21c1
Sequence:CCGGCTATCACTTCAAACTGAAATTCTCGAGAATTTCAGTTTGAAGTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1026s21c1
Sequence:CCGGAGAGTATGCGATGTGCTTAAACTCGAGTTTAAGCACATCGCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1677s21c1
Sequence:CCGGCCATTCTCCTTGAAAGGACTTCTCGAGAAGTCCTTTCAAGGAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1230s21c1
Sequence:CCGGGCTGAATTTAACACCCTCTATCTCGAGATAGAGGGTGTTAAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000963.2-1487s21c1
Sequence:CCGGTGAGTACCGCAAACGCTTTATCTCGAGATAAAGCGTTTGCGGTACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000963.1-1227s1c1
Sequence:CCGGGCTGAATTTAACACCCTCTATCTCGAGATAGAGGGTGTTAAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_000963.1-1460s1c1
Sequence:CCGGGCAGATGAAATACCAGTCTTTCTCGAGAAAGACTGGTATTTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000963.1-665s1c1
Sequence:CCGGCCAGGGCTCAAACATGATGTTCTCGAGAACATCATGTTTGAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000963.1-1674s1c1
Sequence:CCGGCCATTCTCCTTGAAAGGACTTCTCGAGAAGTCCTTTCAAGGAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000963.1-392s1c1
Sequence:CCGGCGTTGTGAATAACATTCCCTTCTCGAGAAGGGAATGTTATTCACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011198
VALIDATED
PTGS2 MISSION shRNA Bacterial Glycerol Stock
prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011198.2-236s1c1
Sequence:CCGGCGGACTGGATTCTATGGTGAACTCGAGTTCACCATAGAATCCAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011198.2-1592s1c1
Sequence:CCGGCCTCGTCCAGATGCTATCTTTCTCGAGAAAGATAGCATCTGGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011198.2-1478s1c1
Sequence:CCGGCCGTACACATCATTTGAAGAACTCGAGTTCTTCAAATGATGTGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011198.2-162s1c1
Sequence:CCGGGCTGTTCCAATCCATGTCAAACTCGAGTTTGACATGGATTGGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011198.2-201s1c1
Sequence:CCGGGCACAGGATTTGACCAGTATACTCGAGTATACTGGTCAAATCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011198
VALIDATED
PTGS2 MISSION shRNA shRNA Plasmid DNA
prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011198.2-236s1c1
Sequence:CCGGCGGACTGGATTCTATGGTGAACTCGAGTTCACCATAGAATCCAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011198.2-1592s1c1
Sequence:CCGGCCTCGTCCAGATGCTATCTTTCTCGAGAAAGATAGCATCTGGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011198.2-1478s1c1
Sequence:CCGGCCGTACACATCATTTGAAGAACTCGAGTTCTTCAAATGATGTGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011198.2-162s1c1
Sequence:CCGGGCTGTTCCAATCCATGTCAAACTCGAGTTTGACATGGATTGGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011198.2-201s1c1
Sequence:CCGGGCACAGGATTTGACCAGTATACTCGAGTATACTGGTCAAATCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011198
VALIDATED
PTGS2 MISSION shRNA Lentiviral Transduction Particles
prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011198.2-236s1c1
Sequence:CCGGCGGACTGGATTCTATGGTGAACTCGAGTTCACCATAGAATCCAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011198.2-1592s1c1
Sequence:CCGGCCTCGTCCAGATGCTATCTTTCTCGAGAAAGATAGCATCTGGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011198.2-1478s1c1
Sequence:CCGGCCGTACACATCATTTGAAGAACTCGAGTTCTTCAAATGATGTGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011198.2-162s1c1
Sequence:CCGGGCTGTTCCAATCCATGTCAAACTCGAGTTTGACATGGATTGGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011198.2-201s1c1
Sequence:CCGGGCACAGGATTTGACCAGTATACTCGAGTATACTGGTCAAATCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks