EMAIL THIS PAGE TO A FRIEND

PTH1R

parathyroid hormone 1 receptor

Synonyms: PFE PTHR PTHR1
UniProtKB ID: Q03431, Q2M1U3
Gene ID:
Human(5745) Summary: The protein encoded by this gene is a member of the G-protein coupled receptor family 2. This protein is a receptor for parathyroid hormone (PTH) and for parathyroid hormone-like hormone (PTHLH). The activity of this receptor is mediated by G proteins which activate adenylyl cyclase and also a phosphatidylinositol-calcium second messenger system. Defects in this receptor are known to be the cause of Jansen's metaphyseal chondrodysplasia (JMC), chondrodysplasia Blomstrand type (BOCD), as well as enchodromatosis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, May 2010]
Mouse(19228) parathyroid hormone 1 receptor
Rat(56813) parathyroid hormone 1 receptor
chicken(420401) parathyroid hormone 1 receptor
Horse(100054278) parathyroid hormone 1 receptor
domestic cat(101095960) parathyroid hormone 1 receptor
dog(403779) parathyroid hormone 1 receptor
cow(507783) parathyroid hormone 1 receptor
sheep(101102017) parathyroid hormone 1 receptor
naked mole-rat(101715956) parathyroid hormone 1 receptor
Domestic Rabbit(100008785) parathyroid hormone 1 receptor
domestic guinea pig(100718340) parathyroid hormone 1 receptor
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1654 Human PTH1R ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011199 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011199 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011199 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000316 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000316 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000316 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU071841 MISSION® esiRNA esiRNA targeting mouse Pth1r (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000316 Rosetta Predictions human pricing
NM_020073 Rosetta Predictions rat pricing
NM_001083935 Rosetta Predictions mouse pricing
NM_001083936 Rosetta Predictions mouse pricing
NM_011199 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000316 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104171 predicted 700
2 SASI_Hs01_00104172 predicted 597
3 SASI_Hs01_00104173 predicted 817
4 SASI_Hs01_00104174 predicted 748
5 SASI_Hs01_00104175 predicted 1701
6 SASI_Hs01_00104176 predicted 1449
7 SASI_Hs01_00104178 predicted 566
8 SASI_Hs01_00104179 predicted 1565
9 SASI_Hs01_00104180 predicted 696
10 SASI_Hs02_00302318 predicted 1255
11 SASI_Hs01_00104177 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020073 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262457 predicted 1283
2 SASI_Rn02_00262458 predicted 579
3 SASI_Rn02_00262459 predicted 426
4 SASI_Rn01_00070453 predicted 275
5 SASI_Rn02_00262460 predicted 1512
6 SASI_Rn02_00262461 predicted 914
7 SASI_Rn02_00262462 predicted 1533
8 SASI_Rn02_00262463 predicted 1455
9 SASI_Rn02_00262464 predicted 1106
10 SASI_Rn02_00262465 predicted 1478
11 SASI_Rn01_00070450 predicted 211
12 SASI_Rn01_00070451 predicted 1180
13 SASI_Rn01_00070452 predicted 247
14 SASI_Rn01_00070454 predicted 618
15 SASI_Rn01_00070455 predicted 469
16 SASI_Rn01_00070456 predicted 333
17 SASI_Rn01_00070457 predicted 459
18 SASI_Rn01_00070458 predicted 1131
19 SASI_Rn01_00070459 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083935 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300086 predicted 1378
2 SASI_Mm02_00300087 predicted 947
3 SASI_Mm02_00300088 predicted 450
4 SASI_Mm02_00300089 predicted 511
5 SASI_Mm02_00300090 predicted 1903
6 SASI_Mm02_00300091 predicted 1706
7 SASI_Mm02_00300092 predicted 1908
8 SASI_Mm02_00300093 predicted 663
9 SASI_Mm02_00300094 predicted 1513
10 SASI_Mm02_00300095 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083936 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300096 predicted 1413
2 SASI_Mm02_00300097 predicted 979
3 SASI_Mm02_00300098 predicted 485
4 SASI_Mm02_00300099 predicted 541
5 SASI_Mm02_00300100 predicted 1931
6 SASI_Mm02_00300101 predicted 1740
7 SASI_Mm02_00300102 predicted 1948
8 SASI_Mm02_00300103 predicted 696
9 SASI_Mm02_00300104 predicted 1549
10 SASI_Mm02_00300105 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011199 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189732 predicted 1380
2 SASI_Mm01_00189733 predicted 942
3 SASI_Mm02_00320115 predicted 449
4 SASI_Mm01_00189738 predicted 508
5 SASI_Mm02_00320116 predicted 1906
6 SASI_Mm02_00320117 predicted 1716
7 SASI_Mm02_00320118 predicted 1914
8 SASI_Mm02_00320119 predicted 668
9 SASI_Mm02_00320120 predicted 1522
10 SASI_Mm02_00320121 predicted 661
11 SASI_Mm01_00189734 predicted 387
12 SASI_Mm01_00189735 predicted 1467
13 SASI_Mm01_00189736 predicted 1491
14 SASI_Mm01_00189737 predicted 880
15 SASI_Mm01_00189739 predicted 1315
16 SASI_Mm01_00189740 predicted 1061
17 SASI_Mm01_00189741 predicted 1367
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011199
PTH1R MISSION shRNA Bacterial Glycerol Stock
parathyroid hormone 1 receptor
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011199.2-951s21c1
Sequence:CCGGGCACATGTTCCTGTCGTTTATCTCGAGATAAACGACAGGAACATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011199.2-845s21c1
Sequence:CCGGTGATCTACACCGTGGGATATTCTCGAGAATATCCCACGGTGTAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011199.1-138s1c1
Sequence:CCGGGCAATGTGACAAGCTGCTCAACTCGAGTTGAGCAGCTTGTCACATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011199.1-877s1c1
Sequence:CCGGGCTACCAACTACTACTGGATTCTCGAGAATCCAGTAGTAGTTGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011199.1-268s1c1
Sequence:CCGGGAGTCTAAAGAGAACAAGGATCTCGAGATCCTTGTTCTCTTTAGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011199.1-1616s1c1
Sequence:CCGGCTCCAGCCATTGAGAACGAAACTCGAGTTTCGTTCTCAATGGCTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011199.1-1432s1c1
Sequence:CCGGGCATTGGACTTCAAGCGTAAACTCGAGTTTACGCTTGAAGTCCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011199
PTH1R MISSION shRNA shRNA Plasmid DNA
parathyroid hormone 1 receptor
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011199.2-951s21c1
Sequence:CCGGGCACATGTTCCTGTCGTTTATCTCGAGATAAACGACAGGAACATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011199.2-845s21c1
Sequence:CCGGTGATCTACACCGTGGGATATTCTCGAGAATATCCCACGGTGTAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011199.1-138s1c1
Sequence:CCGGGCAATGTGACAAGCTGCTCAACTCGAGTTGAGCAGCTTGTCACATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011199.1-877s1c1
Sequence:CCGGGCTACCAACTACTACTGGATTCTCGAGAATCCAGTAGTAGTTGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011199.1-268s1c1
Sequence:CCGGGAGTCTAAAGAGAACAAGGATCTCGAGATCCTTGTTCTCTTTAGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011199.1-1616s1c1
Sequence:CCGGCTCCAGCCATTGAGAACGAAACTCGAGTTTCGTTCTCAATGGCTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011199.1-1432s1c1
Sequence:CCGGGCATTGGACTTCAAGCGTAAACTCGAGTTTACGCTTGAAGTCCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011199
PTH1R MISSION shRNA Lentiviral Transduction Particles
parathyroid hormone 1 receptor
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011199.2-951s21c1
Sequence:CCGGGCACATGTTCCTGTCGTTTATCTCGAGATAAACGACAGGAACATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011199.2-845s21c1
Sequence:CCGGTGATCTACACCGTGGGATATTCTCGAGAATATCCCACGGTGTAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011199.1-138s1c1
Sequence:CCGGGCAATGTGACAAGCTGCTCAACTCGAGTTGAGCAGCTTGTCACATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011199.1-877s1c1
Sequence:CCGGGCTACCAACTACTACTGGATTCTCGAGAATCCAGTAGTAGTTGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011199.1-268s1c1
Sequence:CCGGGAGTCTAAAGAGAACAAGGATCTCGAGATCCTTGTTCTCTTTAGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011199.1-1616s1c1
Sequence:CCGGCTCCAGCCATTGAGAACGAAACTCGAGTTTCGTTCTCAATGGCTGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011199.1-1432s1c1
Sequence:CCGGGCATTGGACTTCAAGCGTAAACTCGAGTTTACGCTTGAAGTCCAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000316
PTH1R MISSION shRNA Bacterial Glycerol Stock
parathyroid hormone 1 receptor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000316.2-1324s21c1
Sequence:CCGGACTTCATCCTCTTCATCAATACTCGAGTATTGATGAAGAGGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000316.2-702s21c1
Sequence:CCGGTACAGCGAGTGTGTCAAATTTCTCGAGAAATTTGACACACTCGCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000316.2-1409s21c1
Sequence:CCGGGTACCGGAAGCTGCTCAAATCCTCGAGGATTTGAGCAGCTTCCGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000316.2-754s21c1
Sequence:CCGGTTGACCGCCTGGGCATGATTTCTCGAGAAATCATGCCCAGGCGGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000316.x-910s1c1
Sequence:CCGGCAACTACTACTGGATTCTGGTCTCGAGACCAGAATCCAGTAGTAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000316.x-1390s1c1
Sequence:CCGGTGTCGCAATCATATACTGTTTCTCGAGAAACAGTATATGATTGCGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000316.x-1159s1c1
Sequence:CCGGCTTCATCAATATCGTCCGGGTCTCGAGACCCGGACGATATTGATGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000316.x-586s1c1
Sequence:CCGGCCTGGGCATGATTTACACCGTCTCGAGACGGTGTAAATCATGCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000316.x-1865s1c1
Sequence:CCGGGATGGGTGGTTGAATGATTTCCTCGAGGAAATCATTCAACCACCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000316
PTH1R MISSION shRNA shRNA Plasmid DNA
parathyroid hormone 1 receptor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000316.2-1324s21c1
Sequence:CCGGACTTCATCCTCTTCATCAATACTCGAGTATTGATGAAGAGGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000316.2-702s21c1
Sequence:CCGGTACAGCGAGTGTGTCAAATTTCTCGAGAAATTTGACACACTCGCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000316.2-1409s21c1
Sequence:CCGGGTACCGGAAGCTGCTCAAATCCTCGAGGATTTGAGCAGCTTCCGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000316.2-754s21c1
Sequence:CCGGTTGACCGCCTGGGCATGATTTCTCGAGAAATCATGCCCAGGCGGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000316.x-910s1c1
Sequence:CCGGCAACTACTACTGGATTCTGGTCTCGAGACCAGAATCCAGTAGTAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000316.x-1390s1c1
Sequence:CCGGTGTCGCAATCATATACTGTTTCTCGAGAAACAGTATATGATTGCGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000316.x-1159s1c1
Sequence:CCGGCTTCATCAATATCGTCCGGGTCTCGAGACCCGGACGATATTGATGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000316.x-586s1c1
Sequence:CCGGCCTGGGCATGATTTACACCGTCTCGAGACGGTGTAAATCATGCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000316.x-1865s1c1
Sequence:CCGGGATGGGTGGTTGAATGATTTCCTCGAGGAAATCATTCAACCACCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000316
PTH1R MISSION shRNA Lentiviral Transduction Particles
parathyroid hormone 1 receptor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000316.2-1324s21c1
Sequence:CCGGACTTCATCCTCTTCATCAATACTCGAGTATTGATGAAGAGGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000316.2-702s21c1
Sequence:CCGGTACAGCGAGTGTGTCAAATTTCTCGAGAAATTTGACACACTCGCTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000316.2-1409s21c1
Sequence:CCGGGTACCGGAAGCTGCTCAAATCCTCGAGGATTTGAGCAGCTTCCGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000316.2-754s21c1
Sequence:CCGGTTGACCGCCTGGGCATGATTTCTCGAGAAATCATGCCCAGGCGGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000316.x-910s1c1
Sequence:CCGGCAACTACTACTGGATTCTGGTCTCGAGACCAGAATCCAGTAGTAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000316.x-1390s1c1
Sequence:CCGGTGTCGCAATCATATACTGTTTCTCGAGAAACAGTATATGATTGCGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000316.x-1159s1c1
Sequence:CCGGCTTCATCAATATCGTCCGGGTCTCGAGACCCGGACGATATTGATGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000316.x-586s1c1
Sequence:CCGGCCTGGGCATGATTTACACCGTCTCGAGACGGTGTAAATCATGCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000316.x-1865s1c1
Sequence:CCGGGATGGGTGGTTGAATGATTTCCTCGAGGAAATCATTCAACCACCCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks