EMAIL THIS PAGE TO A FRIEND

PTMS

parathymosin

Synonyms: ParaT
UniProtKB ID: P20962
Gene ID:
Mouse(69202) parathymosin
Rat(83801) parathymosin
chicken(418286) parathymosin
dog(611633) parathymosin
cow(613777) parathymosin
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026988 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026988 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026988 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002824 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002824 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002824 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002824 Rosetta Predictions human pricing
NM_031975 Rosetta Predictions rat pricing
NM_026988 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002824 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109752 predicted 883
2 SASI_Hs01_00109754 predicted 841
3 SASI_Hs01_00109756 predicted 875
4 SASI_Hs01_00109757 predicted 781
5 SASI_Hs01_00109759 predicted 782
6 SASI_Hs01_00109753 predicted 835
7 SASI_Hs01_00109758 predicted 810
8 SASI_Hs01_00109755 predicted 845
9 SASI_Hs01_00109760 predicted 579
10 SASI_Hs01_00109761 predicted 712
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031975 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265367 predicted 542
2 SASI_Rn01_00091071 predicted 653
3 SASI_Rn01_00091072 predicted 644
4 SASI_Rn01_00091073 predicted 647
5 SASI_Rn01_00091075 predicted 653
6 SASI_Rn02_00265368 predicted 676
7 SASI_Rn01_00091077 predicted 552
8 SASI_Rn01_00091078 predicted 641
9 SASI_Rn01_00091079 predicted 561
10 SASI_Rn02_00265369 predicted 658
11 SASI_Rn01_00091074 predicted 547
12 SASI_Rn01_00091076 predicted 548
13 SASI_Rn01_00091080 predicted 658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026988 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079085 predicted 861
2 SASI_Mm01_00079086 predicted 863
3 SASI_Mm01_00079087 predicted 863
4 SASI_Mm01_00079088 predicted 859
5 SASI_Mm01_00079089 predicted 861
6 SASI_Mm01_00079090 predicted 873
7 SASI_Mm01_00079091 predicted 902
8 SASI_Mm01_00079093 predicted 862
9 SASI_Mm01_00079094 predicted 739
10 SASI_Mm02_00331328 predicted 765
11 SASI_Mm01_00079092 predicted 874
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026988
VALIDATED
PTMS MISSION shRNA Bacterial Glycerol Stock
parathymosin
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026988.1-596s21c1
Sequence:CCGGCCAAGAGGCAGAAGACAGAAACTCGAGTTTCTGTCTTCTGCCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026988.1-874s21c1
Sequence:CCGGCCTAGCATTCTTGTTCTTCTTCTCGAGAAGAAGAACAAGAATGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026988.1-364s21c1
Sequence:CCGGAGTGCCAAGGACCTGAAAGAACTCGAGTTCTTTCAGGTCCTTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026988.1-414s21c1
Sequence:CCGGCCGGAAAGAACGGAAGAAAGACTCGAGTCTTTCTTCCGTTCTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026988.1-558s21c1
Sequence:CCGGGCGGAAGAGAACTGCTGAAGACTCGAGTCTTCAGCAGTTCTCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026988.1-460s1c1
Sequence:CCGGGCTGAGGAAGAGGAAGAAGAACTCGAGTTCTTCTTCCTCTTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026988.1-414s1c1
Sequence:CCGGCCGGAAAGAACGGAAGAAAGACTCGAGTCTTTCTTCCGTTCTTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026988.1-874s1c1
Sequence:CCGGCCTAGCATTCTTGTTCTTCTTCTCGAGAAGAAGAACAAGAATGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191312    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026988.1-875s1c1
Sequence:CCGGCTAGCATTCTTGTTCTTCTTTCTCGAGAAAGAAGAACAAGAATGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026988.1-472s1c1
Sequence:CCGGGAAGAAGAAACTGCAGAGGATCTCGAGATCCTCTGCAGTTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201020    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026988.1-883s1c1
Sequence:CCGGCTTGTTCTTCTTTCCTGCCTTCTCGAGAAGGCAGGAAAGAAGAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026988
VALIDATED
PTMS MISSION shRNA shRNA Plasmid DNA
parathymosin
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026988.1-596s21c1
Sequence:CCGGCCAAGAGGCAGAAGACAGAAACTCGAGTTTCTGTCTTCTGCCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026988.1-874s21c1
Sequence:CCGGCCTAGCATTCTTGTTCTTCTTCTCGAGAAGAAGAACAAGAATGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026988.1-364s21c1
Sequence:CCGGAGTGCCAAGGACCTGAAAGAACTCGAGTTCTTTCAGGTCCTTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026988.1-414s21c1
Sequence:CCGGCCGGAAAGAACGGAAGAAAGACTCGAGTCTTTCTTCCGTTCTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026988.1-558s21c1
Sequence:CCGGGCGGAAGAGAACTGCTGAAGACTCGAGTCTTCAGCAGTTCTCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026988.1-460s1c1
Sequence:CCGGGCTGAGGAAGAGGAAGAAGAACTCGAGTTCTTCTTCCTCTTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026988.1-414s1c1
Sequence:CCGGCCGGAAAGAACGGAAGAAAGACTCGAGTCTTTCTTCCGTTCTTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026988.1-874s1c1
Sequence:CCGGCCTAGCATTCTTGTTCTTCTTCTCGAGAAGAAGAACAAGAATGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191312    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026988.1-875s1c1
Sequence:CCGGCTAGCATTCTTGTTCTTCTTTCTCGAGAAAGAAGAACAAGAATGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026988.1-472s1c1
Sequence:CCGGGAAGAAGAAACTGCAGAGGATCTCGAGATCCTCTGCAGTTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201020    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026988.1-883s1c1
Sequence:CCGGCTTGTTCTTCTTTCCTGCCTTCTCGAGAAGGCAGGAAAGAAGAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026988
VALIDATED
PTMS MISSION shRNA Lentiviral Transduction Particles
parathymosin
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026988.1-596s21c1
Sequence:CCGGCCAAGAGGCAGAAGACAGAAACTCGAGTTTCTGTCTTCTGCCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026988.1-874s21c1
Sequence:CCGGCCTAGCATTCTTGTTCTTCTTCTCGAGAAGAAGAACAAGAATGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026988.1-364s21c1
Sequence:CCGGAGTGCCAAGGACCTGAAAGAACTCGAGTTCTTTCAGGTCCTTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026988.1-414s21c1
Sequence:CCGGCCGGAAAGAACGGAAGAAAGACTCGAGTCTTTCTTCCGTTCTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026988.1-558s21c1
Sequence:CCGGGCGGAAGAGAACTGCTGAAGACTCGAGTCTTCAGCAGTTCTCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026988.1-460s1c1
Sequence:CCGGGCTGAGGAAGAGGAAGAAGAACTCGAGTTCTTCTTCCTCTTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026988.1-414s1c1
Sequence:CCGGCCGGAAAGAACGGAAGAAAGACTCGAGTCTTTCTTCCGTTCTTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026988.1-874s1c1
Sequence:CCGGCCTAGCATTCTTGTTCTTCTTCTCGAGAAGAAGAACAAGAATGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191312    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026988.1-875s1c1
Sequence:CCGGCTAGCATTCTTGTTCTTCTTTCTCGAGAAAGAAGAACAAGAATGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026988.1-472s1c1
Sequence:CCGGGAAGAAGAAACTGCAGAGGATCTCGAGATCCTCTGCAGTTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201020    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026988.1-883s1c1
Sequence:CCGGCTTGTTCTTCTTTCCTGCCTTCTCGAGAAGGCAGGAAAGAAGAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002824
VALIDATED
PTMS MISSION shRNA Bacterial Glycerol Stock
parathymosin
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000140823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002824.4-382s1c1
Sequence:CCGGGAAGGAGAAGAAGGAGAAGGTCTCGAGACCTTCTCCTTCTTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002824.4-476s1c1
Sequence:CCGGGAAGAAGAAACTGCCGAGGATCTCGAGATCCTCGGCAGTTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002824.4-464s1c1
Sequence:CCGGGCTGAGGAGGAAGAAGAAGAACTCGAGTTCTTCTTCTTCCTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002824.4-418s1c1
Sequence:CCGGCCGGAAAGAGCGAAAGAAAGACTCGAGTCTTTCTTTCGCTCTTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002824.4-373s1c1
Sequence:CCGGCAAGGACCTGAAGGAGAAGAACTCGAGTTCTTCTCCTTCAGGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002824.4-603s1c1
Sequence:CCGGCCAAACGGCAGAAGACAGAAACTCGAGTTTCTGTCTTCTGCCGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002824.4-494s1c1
Sequence:CCGGGATGGAGAGGAGGAAGATGAACTCGAGTTCATCTTCCTCCTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002824.4-379s1c1
Sequence:CCGGCCTGAAGGAGAAGAAGGAGAACTCGAGTTCTCCTTCTTCTCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002824.4-602s1c1
Sequence:CCGGCCCAAACGGCAGAAGACAGAACTCGAGTTCTGTCTTCTGCCGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002824.4-533s1c1
Sequence:CCGGGAAGAAGAAGAAGAGGATGATCTCGAGATCATCCTCTTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002824.4-524s1c1
Sequence:CCGGGAAGATGAGGAAGAAGAAGAACTCGAGTTCTTCTTCTTCCTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002824.4-536s1c1
Sequence:CCGGGAAGAAGAAGAGGATGATGAACTCGAGTTCATCATCCTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002824.4-521s1c1
Sequence:CCGGGAAGAAGATGAGGAAGAAGAACTCGAGTTCTTCTTCCTCATCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002824.4-518s1c1
Sequence:CCGGGAAGAAGAAGATGAGGAAGAACTCGAGTTCTTCCTCATCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002824
VALIDATED
PTMS MISSION shRNA shRNA Plasmid DNA
parathymosin
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000140823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002824.4-382s1c1
Sequence:CCGGGAAGGAGAAGAAGGAGAAGGTCTCGAGACCTTCTCCTTCTTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002824.4-476s1c1
Sequence:CCGGGAAGAAGAAACTGCCGAGGATCTCGAGATCCTCGGCAGTTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002824.4-464s1c1
Sequence:CCGGGCTGAGGAGGAAGAAGAAGAACTCGAGTTCTTCTTCTTCCTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002824.4-418s1c1
Sequence:CCGGCCGGAAAGAGCGAAAGAAAGACTCGAGTCTTTCTTTCGCTCTTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002824.4-373s1c1
Sequence:CCGGCAAGGACCTGAAGGAGAAGAACTCGAGTTCTTCTCCTTCAGGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002824.4-603s1c1
Sequence:CCGGCCAAACGGCAGAAGACAGAAACTCGAGTTTCTGTCTTCTGCCGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002824.4-494s1c1
Sequence:CCGGGATGGAGAGGAGGAAGATGAACTCGAGTTCATCTTCCTCCTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002824.4-379s1c1
Sequence:CCGGCCTGAAGGAGAAGAAGGAGAACTCGAGTTCTCCTTCTTCTCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002824.4-602s1c1
Sequence:CCGGCCCAAACGGCAGAAGACAGAACTCGAGTTCTGTCTTCTGCCGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002824.4-533s1c1
Sequence:CCGGGAAGAAGAAGAAGAGGATGATCTCGAGATCATCCTCTTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002824.4-524s1c1
Sequence:CCGGGAAGATGAGGAAGAAGAAGAACTCGAGTTCTTCTTCTTCCTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002824.4-536s1c1
Sequence:CCGGGAAGAAGAAGAGGATGATGAACTCGAGTTCATCATCCTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002824.4-521s1c1
Sequence:CCGGGAAGAAGATGAGGAAGAAGAACTCGAGTTCTTCTTCCTCATCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002824.4-518s1c1
Sequence:CCGGGAAGAAGAAGATGAGGAAGAACTCGAGTTCTTCCTCATCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002824
VALIDATED
PTMS MISSION shRNA Lentiviral Transduction Particles
parathymosin
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000140823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002824.4-382s1c1
Sequence:CCGGGAAGGAGAAGAAGGAGAAGGTCTCGAGACCTTCTCCTTCTTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002824.4-476s1c1
Sequence:CCGGGAAGAAGAAACTGCCGAGGATCTCGAGATCCTCGGCAGTTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002824.4-464s1c1
Sequence:CCGGGCTGAGGAGGAAGAAGAAGAACTCGAGTTCTTCTTCTTCCTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002824.4-418s1c1
Sequence:CCGGCCGGAAAGAGCGAAAGAAAGACTCGAGTCTTTCTTTCGCTCTTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002824.4-373s1c1
Sequence:CCGGCAAGGACCTGAAGGAGAAGAACTCGAGTTCTTCTCCTTCAGGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002824.4-603s1c1
Sequence:CCGGCCAAACGGCAGAAGACAGAAACTCGAGTTTCTGTCTTCTGCCGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140355    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002824.4-494s1c1
Sequence:CCGGGATGGAGAGGAGGAAGATGAACTCGAGTTCATCTTCCTCCTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002824.4-379s1c1
Sequence:CCGGCCTGAAGGAGAAGAAGGAGAACTCGAGTTCTCCTTCTTCTCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002824.4-602s1c1
Sequence:CCGGCCCAAACGGCAGAAGACAGAACTCGAGTTCTGTCTTCTGCCGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002824.4-533s1c1
Sequence:CCGGGAAGAAGAAGAAGAGGATGATCTCGAGATCATCCTCTTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002824.4-524s1c1
Sequence:CCGGGAAGATGAGGAAGAAGAAGAACTCGAGTTCTTCTTCTTCCTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002824.4-536s1c1
Sequence:CCGGGAAGAAGAAGAGGATGATGAACTCGAGTTCATCATCCTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002824.4-521s1c1
Sequence:CCGGGAAGAAGATGAGGAAGAAGAACTCGAGTTCTTCTTCCTCATCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002824.4-518s1c1
Sequence:CCGGGAAGAAGAAGATGAGGAAGAACTCGAGTTCTTCCTCATCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks