EMAIL THIS PAGE TO A FRIEND

PTP4A2

protein tyrosine phosphatase type IVA, member 2

Synonyms: HH13 HH7-2 HU-PP-1 OV-1 PRL-2 PRL2 PTP4A PTPCAAX2 ptp-IV1a ptp-IV1b
Gene ID:
Human(8073) Summary: The protein encoded by this gene belongs to a small class of the protein tyrosine phosphatase (PTP) family. PTPs are cell signaling molecules that play regulatory roles in a variety of cellular processes. PTPs in this class contain a protein tyrosine phosphatase catalytic domain and a characteristic C-terminal prenylation motif. This PTP has been shown to primarily associate with plasmic and endosomal membrane through its C-terminal prenylation. This PTP was found to interact with the beta-subunit of Rab geranylgeranyltransferase II (beta GGT II), and thus may function as a regulator of GGT II activity. Overexpression of this gene in mammalian cells conferred a transformed phenotype, which suggested its role in tumorigenesis. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 11, 12 and 17. [provided by RefSeq, Aug 2010]
Mouse(19244) protein tyrosine phosphatase 4a2
Rat(85237) protein tyrosine phosphatase 4a2
Zebrafish(334483) protein tyrosine phosphatase type IVA, member 2
domestic cat(101097001) protein tyrosine phosphatase type IVA, member 2
dog(609835) protein tyrosine phosphatase type IVA, member 2
chicken(419649) protein tyrosine phosphatase type IVA, member 2
cow(614435) protein tyrosine phosphatase type IVA, member 2
sheep(101118084) protein tyrosine phosphatase type IVA, member 2
domestic guinea pig(100731020) protein tyrosine phosphatase type IVA, member 2
naked mole-rat(101707478) protein tyrosine phosphatase type IVA, member 2
123 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080391 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080391 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080391 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008974 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008974 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008974 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003479 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003479 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003479 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080391 Rosetta Predictions human pricing
NM_080392 Rosetta Predictions human pricing
NM_053475 Rosetta Predictions rat pricing
NM_008974 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218632 predicted 1119
2 SASI_Hs01_00218634 predicted 1017
3 SASI_Hs02_00362234 predicted 1070
4 SASI_Hs01_00218637 predicted 1057
5 SASI_Hs02_00362235 predicted 1104
6 SASI_Hs02_00362236 predicted 1513
7 SASI_Hs02_00362237 predicted 1249
8 SASI_Hs02_00362238 predicted 1525
9 SASI_Hs02_00362239 predicted 1109
10 SASI_Hs02_00362240 predicted 1062
11 SASI_Hs01_00218631 predicted 1525
12 SASI_Hs01_00218633 predicted 1214
13 SASI_Hs01_00218635 predicted 1458
14 SASI_Hs01_00218636 predicted 1450
15 SASI_Hs01_00218638 predicted 1219
16 SASI_Hs01_00218639 predicted 1407
17 SASI_Hs01_00218640 predicted 1147
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080392 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072611 predicted 1160
2 SASI_Hs01_00072612 predicted 1121
3 SASI_Hs01_00072613 predicted 1017
4 SASI_Hs02_00362241 predicted 1544
5 SASI_Hs01_00072615 predicted 1077
6 SASI_Hs02_00362242 predicted 1628
7 SASI_Hs01_00072617 predicted 1056
8 SASI_Hs02_00362243 predicted 1104
9 SASI_Hs02_00362244 predicted 1304
10 SASI_Hs02_00362245 predicted 1630
11 SASI_Hs01_00072610 predicted 1316
12 SASI_Hs01_00072614 predicted 1247
13 SASI_Hs01_00072616 predicted 1243
14 SASI_Hs01_00072618 predicted 1202
15 SASI_Hs01_00072619 predicted 1371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053475 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078080 predicted 765
2 SASI_Rn01_00078081 predicted 745
3 SASI_Rn01_00078082 predicted 859
4 SASI_Rn02_00266069 predicted 583
5 SASI_Rn01_00078083 predicted 620
6 SASI_Rn02_00266070 predicted 781
7 SASI_Rn01_00078084 predicted 588
8 SASI_Rn01_00078085 predicted 576
9 SASI_Rn01_00078086 predicted 582
10 SASI_Rn01_00078087 predicted 856
11 SASI_Rn01_00078088 predicted 852
12 SASI_Rn01_00078089 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008974 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127598 predicted 330
2 SASI_Mm02_00315054 predicted 661
3 SASI_Mm01_00127599 predicted 733
4 SASI_Mm01_00127600 predicted 708
5 SASI_Mm01_00127601 predicted 334
6 SASI_Mm01_00127602 predicted 555
7 SASI_Mm02_00315055 predicted 557
8 SASI_Mm01_00127604 predicted 759
9 SASI_Mm01_00127605 predicted 631
10 SASI_Mm01_00127606 predicted 748
11 SASI_Mm01_00127597 predicted 298
12 SASI_Mm01_00127603 predicted 862
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080391
VALIDATED
PTP4A2 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase type IVA, member 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080391.2-1111s21c1
Sequence:GTACCGGGACGACTTTGGTTCGAGTTTGCTCGAGCAAACTCGAACCAAAGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080391.2-1759s21c1
Sequence:CCGGTTTCTGCCAGGATTGAATTATCTCGAGATAATTCAATCCTGGCAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080391.2-1220s21c1
Sequence:CCGGCAGATAGTAGATGATTGGTTACTCGAGTAACCAATCATCTACTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080391.2-1438s21c1
Sequence:CCGGATACCGACCTAAGATGCGATTCTCGAGAATCGCATCTTAGGTCGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080391.2-1462s21c1
Sequence:CCGGCTTCAGAGATACCAATGGGCACTCGAGTGCCCATTGGTATCTCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080391.2-1176s21c1
Sequence:CCGGACGTTCTAGATTGGCCATTTGCTCGAGCAAATGGCCAATCTAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080391
VALIDATED
PTP4A2 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase type IVA, member 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080391.2-1111s21c1
Sequence:GTACCGGGACGACTTTGGTTCGAGTTTGCTCGAGCAAACTCGAACCAAAGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080391.2-1759s21c1
Sequence:CCGGTTTCTGCCAGGATTGAATTATCTCGAGATAATTCAATCCTGGCAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080391.2-1220s21c1
Sequence:CCGGCAGATAGTAGATGATTGGTTACTCGAGTAACCAATCATCTACTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080391.2-1438s21c1
Sequence:CCGGATACCGACCTAAGATGCGATTCTCGAGAATCGCATCTTAGGTCGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080391.2-1462s21c1
Sequence:CCGGCTTCAGAGATACCAATGGGCACTCGAGTGCCCATTGGTATCTCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080391.2-1176s21c1
Sequence:CCGGACGTTCTAGATTGGCCATTTGCTCGAGCAAATGGCCAATCTAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080391
VALIDATED
PTP4A2 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase type IVA, member 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080391.2-1111s21c1
Sequence:GTACCGGGACGACTTTGGTTCGAGTTTGCTCGAGCAAACTCGAACCAAAGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080391.2-1759s21c1
Sequence:CCGGTTTCTGCCAGGATTGAATTATCTCGAGATAATTCAATCCTGGCAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080391.2-1220s21c1
Sequence:CCGGCAGATAGTAGATGATTGGTTACTCGAGTAACCAATCATCTACTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080391.2-1438s21c1
Sequence:CCGGATACCGACCTAAGATGCGATTCTCGAGAATCGCATCTTAGGTCGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080391.2-1462s21c1
Sequence:CCGGCTTCAGAGATACCAATGGGCACTCGAGTGCCCATTGGTATCTCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_080391.2-1176s21c1
Sequence:CCGGACGTTCTAGATTGGCCATTTGCTCGAGCAAATGGCCAATCTAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008974
VALIDATED
PTP4A2 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase type IVA, member 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008974.3-601s21c1
Sequence:CCGGGCTGTGTTCAGTAGAAGTAGACTCGAGTCTACTTCTACTGAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008974.3-572s21c1
Sequence:CCGGGTTACGCTTCAGAGATACCAACTCGAGTTGGTATCTCTGAAGCGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008974.3-462s21c1
Sequence:CCGGGAATGCGGAATGAAGTATGAACTCGAGTTCATACTTCATTCCGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008974.3-137s21c1
Sequence:CCGGCTCTTATGAGAACATGCGTTTCTCGAGAAACGCATGTTCTCATAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008974.2-653s1c1
Sequence:CCGGCCTAATCAGATAGTAGATGATCTCGAGATCATCTACTATCTGATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008974.2-895s1c1
Sequence:CCGGGTTACGCTTCAGAGATACCAACTCGAGTTGGTATCTCTGAAGCGTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008974.2-460s1c1
Sequence:CCGGCTCTTATGAGAACATGCGTTTCTCGAGAAACGCATGTTCTCATAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008974.2-785s1c1
Sequence:CCGGGAATGCGGAATGAAGTATGAACTCGAGTTCATACTTCATTCCGCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008974.2-726s1c1
Sequence:CCGGCAGTGCATTGTGTTGCAGGATCTCGAGATCCTGCAACACAATGCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008974
VALIDATED
PTP4A2 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase type IVA, member 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008974.3-601s21c1
Sequence:CCGGGCTGTGTTCAGTAGAAGTAGACTCGAGTCTACTTCTACTGAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008974.3-572s21c1
Sequence:CCGGGTTACGCTTCAGAGATACCAACTCGAGTTGGTATCTCTGAAGCGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008974.3-462s21c1
Sequence:CCGGGAATGCGGAATGAAGTATGAACTCGAGTTCATACTTCATTCCGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008974.3-137s21c1
Sequence:CCGGCTCTTATGAGAACATGCGTTTCTCGAGAAACGCATGTTCTCATAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008974.2-653s1c1
Sequence:CCGGCCTAATCAGATAGTAGATGATCTCGAGATCATCTACTATCTGATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008974.2-895s1c1
Sequence:CCGGGTTACGCTTCAGAGATACCAACTCGAGTTGGTATCTCTGAAGCGTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008974.2-460s1c1
Sequence:CCGGCTCTTATGAGAACATGCGTTTCTCGAGAAACGCATGTTCTCATAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008974.2-785s1c1
Sequence:CCGGGAATGCGGAATGAAGTATGAACTCGAGTTCATACTTCATTCCGCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008974.2-726s1c1
Sequence:CCGGCAGTGCATTGTGTTGCAGGATCTCGAGATCCTGCAACACAATGCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008974
VALIDATED
PTP4A2 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase type IVA, member 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008974.3-601s21c1
Sequence:CCGGGCTGTGTTCAGTAGAAGTAGACTCGAGTCTACTTCTACTGAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008974.3-572s21c1
Sequence:CCGGGTTACGCTTCAGAGATACCAACTCGAGTTGGTATCTCTGAAGCGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008974.3-462s21c1
Sequence:CCGGGAATGCGGAATGAAGTATGAACTCGAGTTCATACTTCATTCCGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008974.3-137s21c1
Sequence:CCGGCTCTTATGAGAACATGCGTTTCTCGAGAAACGCATGTTCTCATAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008974.2-653s1c1
Sequence:CCGGCCTAATCAGATAGTAGATGATCTCGAGATCATCTACTATCTGATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008974.2-895s1c1
Sequence:CCGGGTTACGCTTCAGAGATACCAACTCGAGTTGGTATCTCTGAAGCGTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008974.2-460s1c1
Sequence:CCGGCTCTTATGAGAACATGCGTTTCTCGAGAAACGCATGTTCTCATAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008974.2-785s1c1
Sequence:CCGGGAATGCGGAATGAAGTATGAACTCGAGTTCATACTTCATTCCGCATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008974.2-726s1c1
Sequence:CCGGCAGTGCATTGTGTTGCAGGATCTCGAGATCCTGCAACACAATGCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003479
VALIDATED
PTP4A2 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase type IVA, member 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003479.x-1135s1c1
Sequence:CCGGTGGTTCGAGTTTGTGATGCTACTCGAGTAGCATCACAAACTCGAACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003479.x-1236s1c1
Sequence:CCGGCAGATAGTAGATGATTGGTTACTCGAGTAACCAATCATCTACTATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003479.x-1454s1c1
Sequence:CCGGATACCGACCTAAGATGCGATTCTCGAGAATCGCATCTTAGGTCGGTATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003479.x-1478s1c1
Sequence:CCGGCTTCAGAGATACCAATGGGCACTCGAGTGCCCATTGGTATCTCTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003479.x-2458s1c1
Sequence:CCGGCCTGTAGAATTGTGGGCTGTACTCGAGTACAGCCCACAATTCTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003479
VALIDATED
PTP4A2 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase type IVA, member 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003479.x-1135s1c1
Sequence:CCGGTGGTTCGAGTTTGTGATGCTACTCGAGTAGCATCACAAACTCGAACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003479.x-1236s1c1
Sequence:CCGGCAGATAGTAGATGATTGGTTACTCGAGTAACCAATCATCTACTATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003479.x-1454s1c1
Sequence:CCGGATACCGACCTAAGATGCGATTCTCGAGAATCGCATCTTAGGTCGGTATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003479.x-1478s1c1
Sequence:CCGGCTTCAGAGATACCAATGGGCACTCGAGTGCCCATTGGTATCTCTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003479.x-2458s1c1
Sequence:CCGGCCTGTAGAATTGTGGGCTGTACTCGAGTACAGCCCACAATTCTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003479
VALIDATED
PTP4A2 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase type IVA, member 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003479.x-1135s1c1
Sequence:CCGGTGGTTCGAGTTTGTGATGCTACTCGAGTAGCATCACAAACTCGAACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003479.x-1236s1c1
Sequence:CCGGCAGATAGTAGATGATTGGTTACTCGAGTAACCAATCATCTACTATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003479.x-1454s1c1
Sequence:CCGGATACCGACCTAAGATGCGATTCTCGAGAATCGCATCTTAGGTCGGTATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003479.x-1478s1c1
Sequence:CCGGCTTCAGAGATACCAATGGGCACTCGAGTGCCCATTGGTATCTCTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003479.x-2458s1c1
Sequence:CCGGCCTGTAGAATTGTGGGCTGTACTCGAGTACAGCCCACAATTCTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks