EMAIL THIS PAGE TO A FRIEND

PTPN13

protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)

Synonyms: FAP-1 PNP1 PTP-BAS PTP-BL PTP1E PTPL1 PTPLE hPTP1E
Gene ID:
Human(5783) Summary: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP is a large intracellular protein. It has a catalytic PTP domain at its C-terminus and two major structural domains: a region with five PDZ domains and a FERM domain that binds to plasma membrane and cytoskeletal elements. This PTP was found to interact with, and dephosphorylate, Fas receptor and IkappaBalpha through the PDZ domains. This suggests it has a role in Fas mediated programmed cell death. This PTP was also shown to interact with GTPase-activating protein, and thus may function as a regulator of Rho signaling pathways. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. [provided by RefSeq, Oct 2008]
Mouse(19249) protein tyrosine phosphatase, non-receptor type 13
Rat(498331) protein tyrosine phosphatase, non-receptor type 13
naked mole-rat(101715582) protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)
domestic guinea pig(100717744) protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)
cow(282333) protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)
sheep(101121266) protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)
Zebrafish(560883) protein tyrosine phosphatase, non-receptor type 13
domestic cat(100144609) protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)
dog(403662) protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)
chicken(422591) protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)
172 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006264 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006264 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006264 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011204 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011204 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011204 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006264 Rosetta Predictions human pricing
NM_080683 Rosetta Predictions human pricing
NM_080684 Rosetta Predictions human pricing
NM_080685 Rosetta Predictions human pricing
XM_001059696 Rosetta Predictions rat pricing
XM_213997 Rosetta Predictions rat pricing
XM_573554 Rosetta Predictions rat pricing
NM_011204 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006264 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148735 predicted 1140
2 SASI_Hs02_00341214 predicted 2434
3 SASI_Hs02_00341215 predicted 1864
4 SASI_Hs01_00148738 predicted 6305
5 SASI_Hs02_00341216 predicted 5715
6 SASI_Hs01_00148740 predicted 1542
7 SASI_Hs02_00341217 predicted 1856
8 SASI_Hs01_00148741 predicted 6688
9 SASI_Hs01_00148742 predicted 7198
10 SASI_Hs01_00148744 predicted 1720
11 SASI_Hs01_00148736 predicted 1283
12 SASI_Hs01_00148737 predicted 465
13 SASI_Hs01_00148739 predicted 5106
14 SASI_Hs01_00148743 predicted 2095
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080683 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106297 predicted 1140
2 SASI_Hs02_00362465 predicted 2430
3 SASI_Hs02_00362466 predicted 1863
4 SASI_Hs01_00106300 predicted 6361
5 SASI_Hs02_00362467 predicted 5774
6 SASI_Hs01_00106302 predicted 1548
7 SASI_Hs02_00362468 predicted 1850
8 SASI_Hs01_00106303 predicted 6743
9 SASI_Hs01_00106304 predicted 7253
10 SASI_Hs01_00106306 predicted 1720
11 SASI_Hs01_00106298 predicted 1284
12 SASI_Hs01_00106299 predicted 466
13 SASI_Hs01_00106301 predicted 5163
14 SASI_Hs01_00106305 predicted 2094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080684 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049544 predicted 1139
2 SASI_Hs02_00362469 predicted 2434
3 SASI_Hs02_00362470 predicted 1864
4 SASI_Hs01_00049547 predicted 5787
5 SASI_Hs02_00362471 predicted 5201
6 SASI_Hs01_00049549 predicted 1544
7 SASI_Hs02_00362472 predicted 1851
8 SASI_Hs01_00049550 predicted 6172
9 SASI_Hs01_00049551 predicted 6681
10 SASI_Hs01_00049553 predicted 1719
11 SASI_Hs01_00049545 predicted 1284
12 SASI_Hs01_00049546 predicted 460
13 SASI_Hs01_00049548 predicted 4596
14 SASI_Hs01_00049552 predicted 2099
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080685 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161175 predicted 1135
2 SASI_Hs02_00362473 predicted 2427
3 SASI_Hs02_00362474 predicted 1863
4 SASI_Hs01_00161178 predicted 6369
5 SASI_Hs02_00362475 predicted 5794
6 SASI_Hs01_00161180 predicted 1539
7 SASI_Hs02_00362476 predicted 1850
8 SASI_Hs01_00161181 predicted 6758
9 SASI_Hs01_00161182 predicted 7266
10 SASI_Hs01_00161184 predicted 1719
11 SASI_Hs01_00161176 predicted 1285
12 SASI_Hs01_00161177 predicted 459
13 SASI_Hs01_00161179 predicted 5186
14 SASI_Hs01_00161183 predicted 2093
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059696 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293998 predicted 4467
2 SASI_Rn02_00293999 predicted 4850
3 SASI_Rn02_00294000 predicted 2940
4 SASI_Rn02_00294001 predicted 2316
5 SASI_Rn02_00294002 predicted 2161
6 SASI_Rn02_00294003 predicted 611
7 SASI_Rn02_00294004 predicted 2811
8 SASI_Rn02_00294005 predicted 1084
9 SASI_Rn02_00294006 predicted 6552
10 SASI_Rn02_00294007 predicted 1012
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213997 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375056 predicted 4285
2 SASI_Rn02_00375057 predicted 4671
3 SASI_Rn02_00375058 predicted 2764
4 SASI_Rn02_00375059 predicted 2133
5 SASI_Rn02_00375060 predicted 1990
6 SASI_Rn02_00375061 predicted 440
7 SASI_Rn02_00375062 predicted 2637
8 SASI_Rn02_00375063 predicted 906
9 SASI_Rn02_00375064 predicted 6374
10 SASI_Rn02_00375065 predicted 836
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573554 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00123872 predicted 780
2 SASI_Rn01_00123873 predicted 1007
3 SASI_Rn01_00123874 predicted 598
4 SASI_Rn01_00123875 predicted 1258
5 SASI_Rn01_00123876 predicted 1319
6 SASI_Rn01_00123877 predicted 1028
7 SASI_Rn01_00123878 predicted 865
8 SASI_Rn01_00123879 predicted 872
9 SASI_Rn01_00123880 predicted 794
10 SASI_Rn01_00123881 predicted 1351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011204 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150765 predicted 2966
2 SASI_Mm01_00150767 predicted 1464
3 SASI_Mm01_00150766 predicted 1117
4 SASI_Mm02_00320135 predicted 4956
5 SASI_Mm01_00150768 predicted 5635
6 SASI_Mm01_00150769 predicted 4573
7 SASI_Mm02_00320136 predicted 4244
8 SASI_Mm01_00150771 predicted 2559
9 SASI_Mm01_00150772 predicted 6039
10 SASI_Mm01_00150773 predicted 3468
11 SASI_Mm01_00150770 predicted 2306
12 SASI_Mm01_00150774 predicted 4458
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006264
VALIDATED
PTPN13 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006264.x-1307s1c1
Sequence:CCGGCCAGTGAAAGTCCATCTATTACTCGAGTAATAGATGGACTTTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006264.x-5158s1c1
Sequence:CCGGCCAGAGTTTGAGGACAGTAATCTCGAGATTACTGTCCTCAAACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006264.x-8004s1c1
Sequence:CCGGGCATCATCTGTTTGTAATCATCTCGAGATGATTACAAACAGATGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006264.x-6679s1c1
Sequence:CCGGCCTTTGGATCAGTGTCTAATTCTCGAGAATTAGACACTGATCCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006264.x-1731s1c1
Sequence:CCGGGCCACGGTCTATTCTTACTAACTCGAGTTAGTAAGAATAGACCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006264
VALIDATED
PTPN13 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006264.x-1307s1c1
Sequence:CCGGCCAGTGAAAGTCCATCTATTACTCGAGTAATAGATGGACTTTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006264.x-5158s1c1
Sequence:CCGGCCAGAGTTTGAGGACAGTAATCTCGAGATTACTGTCCTCAAACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006264.x-8004s1c1
Sequence:CCGGGCATCATCTGTTTGTAATCATCTCGAGATGATTACAAACAGATGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006264.x-6679s1c1
Sequence:CCGGCCTTTGGATCAGTGTCTAATTCTCGAGAATTAGACACTGATCCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006264.x-1731s1c1
Sequence:CCGGGCCACGGTCTATTCTTACTAACTCGAGTTAGTAAGAATAGACCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006264
VALIDATED
PTPN13 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006264.x-1307s1c1
Sequence:CCGGCCAGTGAAAGTCCATCTATTACTCGAGTAATAGATGGACTTTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006264.x-5158s1c1
Sequence:CCGGCCAGAGTTTGAGGACAGTAATCTCGAGATTACTGTCCTCAAACTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006264.x-8004s1c1
Sequence:CCGGGCATCATCTGTTTGTAATCATCTCGAGATGATTACAAACAGATGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006264.x-6679s1c1
Sequence:CCGGCCTTTGGATCAGTGTCTAATTCTCGAGAATTAGACACTGATCCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006264.x-1731s1c1
Sequence:CCGGGCCACGGTCTATTCTTACTAACTCGAGTTAGTAAGAATAGACCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011204
PTPN13 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011204.1-2107s1c1
Sequence:CCGGCCAGGCAGAGTATGGAGATTACTCGAGTAATCTCCATACTCTGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011204.1-1833s1c1
Sequence:CCGGCCACCCGCAAAGAGAATGAATCTCGAGATTCATTCTCTTTGCGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011204.1-99s1c1
Sequence:CCGGGCCTGCAAGAAGTATTTAGAACTCGAGTTCTAAATACTTCTTGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011204.1-7066s1c1
Sequence:CCGGCCTGCTCACATTCATCTCCTACTCGAGTAGGAGATGAATGTGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011204.1-5429s1c1
Sequence:CCGGCGGCTTATAAAGGTTAATGATCTCGAGATCATTAACCTTTATAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011204
PTPN13 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011204.1-2107s1c1
Sequence:CCGGCCAGGCAGAGTATGGAGATTACTCGAGTAATCTCCATACTCTGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011204.1-1833s1c1
Sequence:CCGGCCACCCGCAAAGAGAATGAATCTCGAGATTCATTCTCTTTGCGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011204.1-99s1c1
Sequence:CCGGGCCTGCAAGAAGTATTTAGAACTCGAGTTCTAAATACTTCTTGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011204.1-7066s1c1
Sequence:CCGGCCTGCTCACATTCATCTCCTACTCGAGTAGGAGATGAATGTGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011204.1-5429s1c1
Sequence:CCGGCGGCTTATAAAGGTTAATGATCTCGAGATCATTAACCTTTATAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011204
PTPN13 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011204.1-2107s1c1
Sequence:CCGGCCAGGCAGAGTATGGAGATTACTCGAGTAATCTCCATACTCTGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011204.1-1833s1c1
Sequence:CCGGCCACCCGCAAAGAGAATGAATCTCGAGATTCATTCTCTTTGCGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011204.1-99s1c1
Sequence:CCGGGCCTGCAAGAAGTATTTAGAACTCGAGTTCTAAATACTTCTTGCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011204.1-7066s1c1
Sequence:CCGGCCTGCTCACATTCATCTCCTACTCGAGTAGGAGATGAATGTGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011204.1-5429s1c1
Sequence:CCGGCGGCTTATAAAGGTTAATGATCTCGAGATCATTAACCTTTATAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks