EMAIL THIS PAGE TO A FRIEND

PTPN18

protein tyrosine phosphatase, non-receptor type 18 (brain-derived)

Synonyms: BDP1 PTP-HSCF
UniProtKB ID: Q99952, B4E1E6, Q53P42
Gene ID:
Human(26469) Summary: The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, the mitotic cycle, and oncogenic transformation. This PTP contains a PEST motif, which often serves as a protein-protein interaction domain, and may be related to protein intracellular half-live. This protein can differentially dephosphorylate autophosphorylated tyrosine kinases that are overexpressed in tumor tissues, and it appears to regulate HER2, a member of the epidermal growth factor receptor family of receptor tyrosine kinases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Mouse(19253) protein tyrosine phosphatase, non-receptor type 18
Rat(301333) protein tyrosine phosphatase, non-receptor type 18
domestic guinea pig(100722394) protein tyrosine phosphatase, non-receptor type 18 (brain-derived)
naked mole-rat(101706897) protein tyrosine phosphatase, non-receptor type 18 (brain-derived)
Domestic Rabbit(100346705) protein tyrosine phosphatase, non-receptor type 18 (brain-derived)
cow(282334) protein tyrosine phosphatase, non-receptor type 18 (brain-derived)
cow(617215) protein tyrosine phosphatase, non-receptor type 18 (brain-derived)
sheep(101116547) protein tyrosine phosphatase, non-receptor type 18 (brain-derived)
Zebrafish(541324) protein tyrosine phosphatase, non-receptor type 18
domestic cat(101091072) protein tyrosine phosphatase, non-receptor type 18 (brain-derived)
Horse(100067347) protein tyrosine phosphatase, non-receptor type 18 (brain-derived)
94 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014369 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014369 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014369 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011206 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011206 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011206 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157311 MISSION® esiRNA esiRNA human PTPN18 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014369 Rosetta Predictions human pricing
NM_001013111 Rosetta Predictions rat pricing
NM_011206 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014369 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345520 predicted 808
2 SASI_Hs01_00076189 predicted 604
3 SASI_Hs01_00076191 predicted 1447
4 SASI_Hs01_00076192 predicted 1588
5 SASI_Hs01_00076193 predicted 570
6 SASI_Hs01_00076194 predicted 456
7 SASI_Hs01_00076196 predicted 1416
8 SASI_Hs02_00345521 predicted 586
9 SASI_Hs01_00076198 predicted 1581
10 SASI_Hs02_00345522 predicted 771
11 SASI_Hs01_00076190 predicted 1544
12 SASI_Hs01_00076195 predicted 838
13 SASI_Hs01_00076197 predicted 827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013111 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061332 predicted 1050
2 SASI_Rn02_00200800 predicted 593
3 SASI_Rn01_00061333 predicted 463
4 SASI_Rn01_00061334 predicted 547
5 SASI_Rn02_00200801 predicted 762
6 SASI_Rn01_00061336 predicted 470
7 SASI_Rn01_00061337 predicted 848
8 SASI_Rn01_00061338 predicted 359
9 SASI_Rn01_00061339 predicted 451
10 SASI_Rn01_00061340 predicted 458
11 SASI_Rn01_00061335 predicted 534
12 SASI_Rn01_00061341 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011206 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026660 predicted 1131
2 SASI_Mm01_00026654 predicted 1292
3 SASI_Mm01_00026656 predicted 317
4 SASI_Mm01_00026657 predicted 586
5 SASI_Mm01_00026661 predicted 1315
6 SASI_Mm02_00320137 predicted 877
7 SASI_Mm02_00320138 predicted 536
8 SASI_Mm02_00320139 predicted 624
9 SASI_Mm01_00026663 predicted 836
10 SASI_Mm02_00320140 predicted 250
11 SASI_Mm01_00026655 predicted 779
12 SASI_Mm01_00026658 predicted 1328
13 SASI_Mm01_00026659 predicted 519
14 SASI_Mm01_00026662 predicted 534
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014369
PTPN18 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, non-receptor type 18 (brain-derived)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014369.3-879s21c1
Sequence:GTACCGGCTCTTTGATGTGGTCCTTAAGCTCGAGCTTAAGGACCACATCAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014369.3-586s21c1
Sequence:GTACCGGTAAAGGAGAAGTGGCTGAATGCTCGAGCATTCAGCCACTTCTCCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014369.3-1891s21c1
Sequence:GTACCGGCAGAACTAAGCCAGGCATAACCTCGAGGTTATGCCTGGCTTAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014369.3-621s21c1
Sequence:GTACCGGAGGACCCTCAAGGTCACATTCCTCGAGGAATGTGACCTTGAGGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014369.3-813s21c1
Sequence:GTACCGGGTCCTGTGCACCGTGGATTATCTCGAGATAATCCACGGTGCACAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014369.3-484s21c1
Sequence:GTACCGGTGATGGCCTGTCGAGAGATAGCTCGAGCTATCTCTCGACAGGCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014369.3-1660s21c1
Sequence:GTACCGGGGAGGAGGTAGCTAGGGTATACTCGAGTATACCCTAGCTACCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014369.x-450s1c1
Sequence:CCGGGCCTGTCGAGAGATAGAGAATCTCGAGATTCTCTATCTCTCGACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014369.x-459s1c1
Sequence:CCGGGAGATAGAGAATGGGCGGAAACTCGAGTTTCCGCCCATTCTCTATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014369.x-970s1c1
Sequence:CCGGACCAGAACATCAAAGAGAATTCTCGAGAATTCTCTTTGATGTTCTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014369
PTPN18 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, non-receptor type 18 (brain-derived)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014369.3-879s21c1
Sequence:GTACCGGCTCTTTGATGTGGTCCTTAAGCTCGAGCTTAAGGACCACATCAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014369.3-586s21c1
Sequence:GTACCGGTAAAGGAGAAGTGGCTGAATGCTCGAGCATTCAGCCACTTCTCCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014369.3-1891s21c1
Sequence:GTACCGGCAGAACTAAGCCAGGCATAACCTCGAGGTTATGCCTGGCTTAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014369.3-621s21c1
Sequence:GTACCGGAGGACCCTCAAGGTCACATTCCTCGAGGAATGTGACCTTGAGGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014369.3-813s21c1
Sequence:GTACCGGGTCCTGTGCACCGTGGATTATCTCGAGATAATCCACGGTGCACAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014369.3-484s21c1
Sequence:GTACCGGTGATGGCCTGTCGAGAGATAGCTCGAGCTATCTCTCGACAGGCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014369.3-1660s21c1
Sequence:GTACCGGGGAGGAGGTAGCTAGGGTATACTCGAGTATACCCTAGCTACCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014369.x-450s1c1
Sequence:CCGGGCCTGTCGAGAGATAGAGAATCTCGAGATTCTCTATCTCTCGACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014369.x-459s1c1
Sequence:CCGGGAGATAGAGAATGGGCGGAAACTCGAGTTTCCGCCCATTCTCTATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014369.x-970s1c1
Sequence:CCGGACCAGAACATCAAAGAGAATTCTCGAGAATTCTCTTTGATGTTCTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014369
PTPN18 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, non-receptor type 18 (brain-derived)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014369.3-879s21c1
Sequence:GTACCGGCTCTTTGATGTGGTCCTTAAGCTCGAGCTTAAGGACCACATCAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014369.3-586s21c1
Sequence:GTACCGGTAAAGGAGAAGTGGCTGAATGCTCGAGCATTCAGCCACTTCTCCTTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014369.3-1891s21c1
Sequence:GTACCGGCAGAACTAAGCCAGGCATAACCTCGAGGTTATGCCTGGCTTAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014369.3-621s21c1
Sequence:GTACCGGAGGACCCTCAAGGTCACATTCCTCGAGGAATGTGACCTTGAGGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014369.3-813s21c1
Sequence:GTACCGGGTCCTGTGCACCGTGGATTATCTCGAGATAATCCACGGTGCACAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014369.3-484s21c1
Sequence:GTACCGGTGATGGCCTGTCGAGAGATAGCTCGAGCTATCTCTCGACAGGCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014369.3-1660s21c1
Sequence:GTACCGGGGAGGAGGTAGCTAGGGTATACTCGAGTATACCCTAGCTACCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014369.x-450s1c1
Sequence:CCGGGCCTGTCGAGAGATAGAGAATCTCGAGATTCTCTATCTCTCGACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014369.x-459s1c1
Sequence:CCGGGAGATAGAGAATGGGCGGAAACTCGAGTTTCCGCCCATTCTCTATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014369.x-970s1c1
Sequence:CCGGACCAGAACATCAAAGAGAATTCTCGAGAATTCTCTTTGATGTTCTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011206
VALIDATED
PTPN18 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, non-receptor type 18 (brain-derived)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011206.2-680s21c1
Sequence:CCGGCCAGCAGTTCTGATCACATTCCTCGAGGAATGTGATCAGAACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011206.2-637s21c1
Sequence:CCGGGTGCACCAGCTACAGTATATGCTCGAGCATATACTGTAGCTGGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011206.2-598s21c1
Sequence:CCGGAGGACCCTCCAGGTTACATTCCTCGAGGAATGTAACCTGGAGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011206.2-248s21c1
Sequence:CCGGCGAACAAGAACCGCTACAAAGCTCGAGCTTTGTAGCGGTTCTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011206.2-158s21c1
Sequence:CCGGCTCGTGAGTTCAGCGACATTACTCGAGTAATGTCGCTGAACTCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011206.1-1315s1c1
Sequence:CCGGGCCTACGAAGAAGTAACAGATCTCGAGATCTGTTACTTCTTCGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011206.1-442s1c1
Sequence:CCGGGTAATCCTGATGGCCTGTCAACTCGAGTTGACAGGCCATCAGGATTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011206.1-145s1c1
Sequence:CCGGGCTCGTGAGTTCAGCGACATTCTCGAGAATGTCGCTGAACTCACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011206.1-225s1c1
Sequence:CCGGGCTTGGGAACACGAACAAGAACTCGAGTTCTTGTTCGTGTTCCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011206.1-248s1c1
Sequence:CCGGGCTACAAAGATGTGGTAGCATCTCGAGATGCTACCACATCTTTGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011206
VALIDATED
PTPN18 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, non-receptor type 18 (brain-derived)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011206.2-680s21c1
Sequence:CCGGCCAGCAGTTCTGATCACATTCCTCGAGGAATGTGATCAGAACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011206.2-637s21c1
Sequence:CCGGGTGCACCAGCTACAGTATATGCTCGAGCATATACTGTAGCTGGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011206.2-598s21c1
Sequence:CCGGAGGACCCTCCAGGTTACATTCCTCGAGGAATGTAACCTGGAGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011206.2-248s21c1
Sequence:CCGGCGAACAAGAACCGCTACAAAGCTCGAGCTTTGTAGCGGTTCTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011206.2-158s21c1
Sequence:CCGGCTCGTGAGTTCAGCGACATTACTCGAGTAATGTCGCTGAACTCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011206.1-1315s1c1
Sequence:CCGGGCCTACGAAGAAGTAACAGATCTCGAGATCTGTTACTTCTTCGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011206.1-442s1c1
Sequence:CCGGGTAATCCTGATGGCCTGTCAACTCGAGTTGACAGGCCATCAGGATTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011206.1-145s1c1
Sequence:CCGGGCTCGTGAGTTCAGCGACATTCTCGAGAATGTCGCTGAACTCACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011206.1-225s1c1
Sequence:CCGGGCTTGGGAACACGAACAAGAACTCGAGTTCTTGTTCGTGTTCCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011206.1-248s1c1
Sequence:CCGGGCTACAAAGATGTGGTAGCATCTCGAGATGCTACCACATCTTTGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011206
VALIDATED
PTPN18 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, non-receptor type 18 (brain-derived)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011206.2-680s21c1
Sequence:CCGGCCAGCAGTTCTGATCACATTCCTCGAGGAATGTGATCAGAACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011206.2-637s21c1
Sequence:CCGGGTGCACCAGCTACAGTATATGCTCGAGCATATACTGTAGCTGGTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011206.2-598s21c1
Sequence:CCGGAGGACCCTCCAGGTTACATTCCTCGAGGAATGTAACCTGGAGGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011206.2-248s21c1
Sequence:CCGGCGAACAAGAACCGCTACAAAGCTCGAGCTTTGTAGCGGTTCTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011206.2-158s21c1
Sequence:CCGGCTCGTGAGTTCAGCGACATTACTCGAGTAATGTCGCTGAACTCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011206.1-1315s1c1
Sequence:CCGGGCCTACGAAGAAGTAACAGATCTCGAGATCTGTTACTTCTTCGTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011206.1-442s1c1
Sequence:CCGGGTAATCCTGATGGCCTGTCAACTCGAGTTGACAGGCCATCAGGATTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011206.1-145s1c1
Sequence:CCGGGCTCGTGAGTTCAGCGACATTCTCGAGAATGTCGCTGAACTCACGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011206.1-225s1c1
Sequence:CCGGGCTTGGGAACACGAACAAGAACTCGAGTTCTTGTTCGTGTTCCCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011206.1-248s1c1
Sequence:CCGGGCTACAAAGATGTGGTAGCATCTCGAGATGCTACCACATCTTTGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks