EMAIL THIS PAGE TO A FRIEND

PTPRCAP

protein tyrosine phosphatase, receptor type, C-associated protein

Synonyms: CD45-AP LPAP
UniProtKB ID: Q14761, B2R512, O00643, Q6I9S6
Gene ID:
Human(5790) Summary: The protein encoded by this gene was identified as a transmembrane phosphoprotein specifically associated with tyrosine phosphatase PTPRC/CD45, a key regulator of T- and B-lymphocyte activation. The interaction with PTPRC may be required for the stable expression of this protein. [provided by RefSeq, Jul 2008]
Mouse(19265) protein tyrosine phosphatase, receptor type, C polypeptide-associated protein
Rat(499300) protein tyrosine phosphatase, receptor type, C-associated protein
domestic guinea pig(100733404) protein tyrosine phosphatase, receptor type, C-associated protein
naked mole-rat(101702558) protein tyrosine phosphatase, receptor type, C-associated protein
cow(618341) protein tyrosine phosphatase, receptor type, C-associated protein
sheep(101119685) protein tyrosine phosphatase, receptor type, C-associated protein
domestic cat(101080917) protein tyrosine phosphatase, receptor type, C-associated protein
dog(611830) protein tyrosine phosphatase, receptor type, C-associated protein
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016933 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016933 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016933 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005608 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005608 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005608 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU161011 MISSION® esiRNA esiRNA targeting mouse Ptprcap mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005608 Rosetta Predictions human pricing
NM_001024289 Rosetta Predictions rat pricing
NM_016933 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005608 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163275 predicted 602
2 SASI_Hs02_00339924 predicted 575
3 SASI_Hs01_00163276 predicted 590
4 SASI_Hs01_00163277 predicted 532
5 SASI_Hs01_00163278 predicted 575
6 SASI_Hs01_00163282 predicted 685
7 SASI_Hs01_00163283 predicted 765
8 SASI_Hs01_00163284 predicted 863
9 SASI_Hs02_00339925 predicted 804
10 SASI_Hs02_00339926 predicted 801
11 SASI_Hs01_00163279 predicted 504
12 SASI_Hs01_00163280 predicted 504
13 SASI_Hs01_00163281 predicted 694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024289 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054801 predicted 606
2 SASI_Rn01_00054802 predicted 401
3 SASI_Rn01_00054803 predicted 238
4 SASI_Rn01_00054804 predicted 371
5 SASI_Rn01_00054805 predicted 598
6 SASI_Rn01_00054806 predicted 425
7 SASI_Rn02_00202475 predicted 563
8 SASI_Rn01_00054809 predicted 562
9 SASI_Rn01_00054810 predicted 594
10 SASI_Rn02_00202476 predicted 238
11 SASI_Rn01_00054807 predicted 357
12 SASI_Rn01_00054808 predicted 532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016933 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109416 predicted 622
2 SASI_Mm01_00109417 predicted 623
3 SASI_Mm01_00109418 predicted 538
4 SASI_Mm01_00109419 predicted 459
5 SASI_Mm01_00109420 predicted 439
6 SASI_Mm02_00323801 predicted 552
7 SASI_Mm01_00109422 predicted 463
8 SASI_Mm01_00109423 predicted 319
9 SASI_Mm02_00323802 predicted 445
10 SASI_Mm01_00109421 predicted 414
11 SASI_Mm01_00109424 predicted 326
12 SASI_Mm01_00109425 predicted 744
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016933
PTPRCAP MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, C-associated protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016933.2-604s1c1
Sequence:CCGGCCTCCGGGTCACTGCACTATACTCGAGTATAGTGCAGTGACCCGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016933.2-194s1c1
Sequence:CCGGCGTCGCCTCAGCCATGCCTCACTCGAGTGAGGCATGGCTGAGGCGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016933.2-176s1c1
Sequence:CCGGGCCCTAGCCTTGGCTTGGCGTCTCGAGACGCCAAGCCAAGGCTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016933.2-527s1c1
Sequence:CCGGGCCCTGCTGAGTGACCTGCATCTCGAGATGCAGGTCACTCAGCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016933.2-413s1c1
Sequence:CCGGGAAGAGGAGCAGCGGTGTCAACTCGAGTTGACACCGCTGCTCCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016933.3-146s21c1
Sequence:CCGGTCCAGTGTGGTCACCATTGTCCTCGAGGACAATGGTGACCACACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016933.3-629s21c1
Sequence:CCGGCTCCGGGTCACTGCACTATAGCTCGAGCTATAGTGCAGTGACCCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016933.3-641s21c1
Sequence:CCGGGCACTATAGGAGTCAGCTTGTCTCGAGACAAGCTGACTCCTATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016933.3-557s21c1
Sequence:CCGGCTGAGTGACCTGCATGCCTTTCTCGAGAAAGGCATGCAGGTCACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016933.3-650s21c1
Sequence:CCGGGAGTCAGCTTGTCCTGTTCCTCTCGAGAGGAACAGGACAAGCTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016933
PTPRCAP MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, C-associated protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016933.2-604s1c1
Sequence:CCGGCCTCCGGGTCACTGCACTATACTCGAGTATAGTGCAGTGACCCGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016933.2-194s1c1
Sequence:CCGGCGTCGCCTCAGCCATGCCTCACTCGAGTGAGGCATGGCTGAGGCGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016933.2-176s1c1
Sequence:CCGGGCCCTAGCCTTGGCTTGGCGTCTCGAGACGCCAAGCCAAGGCTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016933.2-527s1c1
Sequence:CCGGGCCCTGCTGAGTGACCTGCATCTCGAGATGCAGGTCACTCAGCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016933.2-413s1c1
Sequence:CCGGGAAGAGGAGCAGCGGTGTCAACTCGAGTTGACACCGCTGCTCCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016933.3-146s21c1
Sequence:CCGGTCCAGTGTGGTCACCATTGTCCTCGAGGACAATGGTGACCACACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016933.3-629s21c1
Sequence:CCGGCTCCGGGTCACTGCACTATAGCTCGAGCTATAGTGCAGTGACCCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016933.3-641s21c1
Sequence:CCGGGCACTATAGGAGTCAGCTTGTCTCGAGACAAGCTGACTCCTATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016933.3-557s21c1
Sequence:CCGGCTGAGTGACCTGCATGCCTTTCTCGAGAAAGGCATGCAGGTCACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016933.3-650s21c1
Sequence:CCGGGAGTCAGCTTGTCCTGTTCCTCTCGAGAGGAACAGGACAAGCTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016933
PTPRCAP MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, C-associated protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016933.2-604s1c1
Sequence:CCGGCCTCCGGGTCACTGCACTATACTCGAGTATAGTGCAGTGACCCGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016933.2-194s1c1
Sequence:CCGGCGTCGCCTCAGCCATGCCTCACTCGAGTGAGGCATGGCTGAGGCGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016933.2-176s1c1
Sequence:CCGGGCCCTAGCCTTGGCTTGGCGTCTCGAGACGCCAAGCCAAGGCTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016933.2-527s1c1
Sequence:CCGGGCCCTGCTGAGTGACCTGCATCTCGAGATGCAGGTCACTCAGCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016933.2-413s1c1
Sequence:CCGGGAAGAGGAGCAGCGGTGTCAACTCGAGTTGACACCGCTGCTCCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016933.3-146s21c1
Sequence:CCGGTCCAGTGTGGTCACCATTGTCCTCGAGGACAATGGTGACCACACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016933.3-629s21c1
Sequence:CCGGCTCCGGGTCACTGCACTATAGCTCGAGCTATAGTGCAGTGACCCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016933.3-641s21c1
Sequence:CCGGGCACTATAGGAGTCAGCTTGTCTCGAGACAAGCTGACTCCTATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016933.3-557s21c1
Sequence:CCGGCTGAGTGACCTGCATGCCTTTCTCGAGAAAGGCATGCAGGTCACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016933.3-650s21c1
Sequence:CCGGGAGTCAGCTTGTCCTGTTCCTCTCGAGAGGAACAGGACAAGCTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005608
PTPRCAP MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor type, C-associated protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052773    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_005608.1-862s1c1
Sequence:CCGGACAGGCATCAGGCAACCATTTCTCGAGAAATGGTTGCCTGATGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005608.1-159s1c1
Sequence:CCGGCTCTGTCACCGTTGTCCTGCTCTCGAGAGCAGGACAACGGTGACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005608.1-390s1c1
Sequence:CCGGTGAGCAGGACACAGACTATGACTCGAGTCATAGTCTGTGTCCTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005608.1-375s1c1
Sequence:CCGGTGAGCGACAGGAGGATGAGCACTCGAGTGCTCATCCTCCTGTCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005608.1-448s1c1
Sequence:CCGGGAAGGCGAGCAGCAATGTGGACTCGAGTCCACATTGCTGCTCGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005608.2-593s21c1
Sequence:CCGGTGAGTGACCTGCACGCCTTTGCTCGAGCAAAGGCGTGCAGGTCACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005608.2-389s21c1
Sequence:CCGGATGAGCAGGACACAGACTATGCTCGAGCATAGTCTGTGTCCTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005608.2-665s21c1
Sequence:CCGGTCCATGTCACCGCACTGTAGACTCGAGTCTACAGTGCGGTGACATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005608.2-356s21c1
Sequence:CCGGGGTCCACAGACAATGACCTTGCTCGAGCAAGGTCATTGTCTGTGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005608
PTPRCAP MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor type, C-associated protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052773    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_005608.1-862s1c1
Sequence:CCGGACAGGCATCAGGCAACCATTTCTCGAGAAATGGTTGCCTGATGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005608.1-159s1c1
Sequence:CCGGCTCTGTCACCGTTGTCCTGCTCTCGAGAGCAGGACAACGGTGACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005608.1-390s1c1
Sequence:CCGGTGAGCAGGACACAGACTATGACTCGAGTCATAGTCTGTGTCCTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005608.1-375s1c1
Sequence:CCGGTGAGCGACAGGAGGATGAGCACTCGAGTGCTCATCCTCCTGTCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005608.1-448s1c1
Sequence:CCGGGAAGGCGAGCAGCAATGTGGACTCGAGTCCACATTGCTGCTCGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005608.2-593s21c1
Sequence:CCGGTGAGTGACCTGCACGCCTTTGCTCGAGCAAAGGCGTGCAGGTCACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005608.2-389s21c1
Sequence:CCGGATGAGCAGGACACAGACTATGCTCGAGCATAGTCTGTGTCCTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005608.2-665s21c1
Sequence:CCGGTCCATGTCACCGCACTGTAGACTCGAGTCTACAGTGCGGTGACATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005608.2-356s21c1
Sequence:CCGGGGTCCACAGACAATGACCTTGCTCGAGCAAGGTCATTGTCTGTGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005608
PTPRCAP MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor type, C-associated protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052773    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_005608.1-862s1c1
Sequence:CCGGACAGGCATCAGGCAACCATTTCTCGAGAAATGGTTGCCTGATGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005608.1-159s1c1
Sequence:CCGGCTCTGTCACCGTTGTCCTGCTCTCGAGAGCAGGACAACGGTGACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005608.1-390s1c1
Sequence:CCGGTGAGCAGGACACAGACTATGACTCGAGTCATAGTCTGTGTCCTGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005608.1-375s1c1
Sequence:CCGGTGAGCGACAGGAGGATGAGCACTCGAGTGCTCATCCTCCTGTCGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005608.1-448s1c1
Sequence:CCGGGAAGGCGAGCAGCAATGTGGACTCGAGTCCACATTGCTGCTCGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005608.2-593s21c1
Sequence:CCGGTGAGTGACCTGCACGCCTTTGCTCGAGCAAAGGCGTGCAGGTCACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005608.2-389s21c1
Sequence:CCGGATGAGCAGGACACAGACTATGCTCGAGCATAGTCTGTGTCCTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005608.2-665s21c1
Sequence:CCGGTCCATGTCACCGCACTGTAGACTCGAGTCTACAGTGCGGTGACATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005608.2-356s21c1
Sequence:CCGGGGTCCACAGACAATGACCTTGCTCGAGCAAGGTCATTGTCTGTGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks