EMAIL THIS PAGE TO A FRIEND

PTPRZ1

protein tyrosine phosphatase, receptor-type, Z polypeptide 1

Synonyms: HPTPZ HPTPzeta PTP-ZETA PTP18 PTPRZ PTPZ R-PTP-zeta-2 RPTPB RPTPbeta phosphacan
UniProtKB ID: P23471, A4D0W5, O76043, Q9UDR6
Gene ID:
Human(5803) Summary: This gene encodes a member of the receptor protein tyrosine phosphatase family. Expression of this gene is restricted to the central nervous system (CNS), and it may be involved in the regulation of specific developmental processes in the CNS. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, May 2011]
Mouse(19283) protein tyrosine phosphatase, receptor type Z, polypeptide 1
Rat(25613) protein tyrosine phosphatase, receptor-type, Z polypeptide 1
chicken(396403) protein tyrosine phosphatase, receptor-type, Z polypeptide 1
domestic cat(101094009) protein tyrosine phosphatase, receptor-type, Z polypeptide 1
dog(482428) protein tyrosine phosphatase, receptor-type, Z polypeptide 1
Horse(100071439) protein tyrosine phosphatase, receptor-type, Z polypeptide 1
domestic guinea pig(100735677) protein tyrosine phosphatase, receptor-type, Z polypeptide 1
naked mole-rat(101708126) protein tyrosine phosphatase, receptor-type, Z polypeptide 1
Domestic Rabbit(100341519) protein tyrosine phosphatase, receptor-type, Z polypeptide 1
cow(317725) protein tyrosine phosphatase, receptor-type, Z polypeptide 1
sheep(101103717) protein tyrosine phosphatase, receptor-type, Z polypeptide 1
Gene Class: Dehydratase
164 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002851 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002851 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002851 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_358362 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_358362 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_358362 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002851 Rosetta Predictions human pricing
NM_013080 Rosetta Predictions rat pricing
NM_001081306 Rosetta Predictions mouse pricing
XM_620293 Rosetta Predictions mouse pricing
XM_888896 Rosetta Predictions mouse pricing
XM_898319 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002851 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144467 predicted 3226
2 SASI_Hs01_00144468 predicted 1569
3 SASI_Hs02_00334591 predicted 7155
4 SASI_Hs01_00144470 predicted 1698
5 SASI_Hs01_00144471 predicted 2906
6 SASI_Hs01_00144472 predicted 2194
7 SASI_Hs02_00334592 predicted 3196
8 SASI_Hs01_00144473 predicted 7023
9 SASI_Hs02_00334593 predicted 3482
10 SASI_Hs02_00334594 predicted 4259
11 SASI_Hs01_00144469 predicted 3887
12 SASI_Hs01_00144474 predicted 984
13 SASI_Hs01_00144475 predicted 1392
14 SASI_Hs01_00144476 predicted 4966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013080 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053277 predicted 289
2 SASI_Rn01_00053278 predicted 1272
3 SASI_Rn02_00260843 predicted 5384
4 SASI_Rn01_00053282 predicted 6355
5 SASI_Rn01_00053284 predicted 783
6 SASI_Rn01_00053285 predicted 2966
7 SASI_Rn02_00260844 predicted 213
8 SASI_Rn02_00260845 predicted 3770
9 SASI_Rn01_00053286 predicted 5949
10 SASI_Rn02_00260846 predicted 5455
11 SASI_Rn01_00053279 predicted 6720
12 SASI_Rn01_00053280 predicted 1429
13 SASI_Rn01_00053281 predicted 216
14 SASI_Rn01_00053283 predicted 5233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081306 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297141 predicted 947
2 SASI_Mm02_00297142 predicted 1545
3 SASI_Mm02_00297143 predicted 3237
4 SASI_Mm02_00297144 predicted 6569
5 SASI_Mm02_00297145 predicted 5597
6 SASI_Mm02_00297146 predicted 1245
7 SASI_Mm02_00297147 predicted 2589
8 SASI_Mm02_00297148 predicted 5662
9 SASI_Mm02_00297149 predicted 5392
10 SASI_Mm02_00297150 predicted 1312
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_620293 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208404 predicted 958
2 SASI_Mm01_00208405 predicted 505
3 SASI_Mm01_00208406 predicted 1547
4 SASI_Mm01_00208407 predicted 3246
5 SASI_Mm01_00208408 predicted 4325
6 SASI_Mm01_00208409 predicted 1243
7 SASI_Mm01_00208410 predicted 2211
8 SASI_Mm01_00208411 predicted 1646
9 SASI_Mm01_00208412 predicted 4045
10 SASI_Mm01_00208413 predicted 2591
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_888896 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272878 predicted 955
2 SASI_Mm01_00272879 predicted 3243
3 SASI_Mm01_00272880 predicted 6568
4 SASI_Mm01_00272881 predicted 5595
5 SASI_Mm01_00272882 predicted 1245
6 SASI_Mm01_00272883 predicted 2594
7 SASI_Mm01_00272884 predicted 5673
8 SASI_Mm01_00272885 predicted 5400
9 SASI_Mm01_00272886 predicted 6967
10 SASI_Mm01_00272887 predicted 1324
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898319 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270826 predicted 1841
2 SASI_Mm01_00270827 predicted 5155
3 SASI_Mm01_00270828 predicted 4175
4 SASI_Mm01_00270829 predicted 5613
5 SASI_Mm01_00270830 predicted 4189
6 SASI_Mm01_00270831 predicted 1197
7 SASI_Mm01_00270832 predicted 379
8 SASI_Mm01_00270833 predicted 4255
9 SASI_Mm01_00270834 predicted 3998
10 SASI_Mm01_00270835 predicted 5551
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002851
PTPRZ1 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor-type, Z polypeptide 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002851.x-5386s1c1
Sequence:CCGGCCAGACAACAAGCACAAGAATCTCGAGATTCTTGTGCTTGTTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002851.x-775s1c1
Sequence:CCGGGCTGCTTTAGATCCATTCATACTCGAGTATGAATGGATCTAAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002917    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002851.x-7692s1c1
Sequence:CCGGCGTAGTTCATTAGCTGGTCTTCTCGAGAAGACCAGCTAATGAACTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002851.x-3453s1c1
Sequence:CCGGCCTTGCTCATACCACCACTAACTCGAGTTAGTGGTGGTATGAGCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002851.x-6564s1c1
Sequence:CCGGGCCTATAAATTGTGAGAGCTTCTCGAGAAGCTCTCACAATTTATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002851.2-6259s21c1
Sequence:CCGGACGAAGGAACTGTCAACATATCTCGAGATATGTTGACAGTTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002851.2-1796s21c1
Sequence:CCGGCAATCGCATAGGGACGAAATACTCGAGTATTTCGTCCCTATGCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002851.2-2200s21c1
Sequence:CCGGACATATCCCAAGGGTATATATCTCGAGATATATACCCTTGGGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002851.2-3306s21c1
Sequence:CCGGATACCTAAGTCTTCGTTAATACTCGAGTATTAACGAAGACTTAGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002851
PTPRZ1 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor-type, Z polypeptide 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002851.x-5386s1c1
Sequence:CCGGCCAGACAACAAGCACAAGAATCTCGAGATTCTTGTGCTTGTTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002851.x-775s1c1
Sequence:CCGGGCTGCTTTAGATCCATTCATACTCGAGTATGAATGGATCTAAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002917    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002851.x-7692s1c1
Sequence:CCGGCGTAGTTCATTAGCTGGTCTTCTCGAGAAGACCAGCTAATGAACTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002851.x-3453s1c1
Sequence:CCGGCCTTGCTCATACCACCACTAACTCGAGTTAGTGGTGGTATGAGCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002851.x-6564s1c1
Sequence:CCGGGCCTATAAATTGTGAGAGCTTCTCGAGAAGCTCTCACAATTTATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002851.2-6259s21c1
Sequence:CCGGACGAAGGAACTGTCAACATATCTCGAGATATGTTGACAGTTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002851.2-1796s21c1
Sequence:CCGGCAATCGCATAGGGACGAAATACTCGAGTATTTCGTCCCTATGCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002851.2-2200s21c1
Sequence:CCGGACATATCCCAAGGGTATATATCTCGAGATATATACCCTTGGGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002851.2-3306s21c1
Sequence:CCGGATACCTAAGTCTTCGTTAATACTCGAGTATTAACGAAGACTTAGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002851
PTPRZ1 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor-type, Z polypeptide 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002851.x-5386s1c1
Sequence:CCGGCCAGACAACAAGCACAAGAATCTCGAGATTCTTGTGCTTGTTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002851.x-775s1c1
Sequence:CCGGGCTGCTTTAGATCCATTCATACTCGAGTATGAATGGATCTAAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002917    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002851.x-7692s1c1
Sequence:CCGGCGTAGTTCATTAGCTGGTCTTCTCGAGAAGACCAGCTAATGAACTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002851.x-3453s1c1
Sequence:CCGGCCTTGCTCATACCACCACTAACTCGAGTTAGTGGTGGTATGAGCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002851.x-6564s1c1
Sequence:CCGGGCCTATAAATTGTGAGAGCTTCTCGAGAAGCTCTCACAATTTATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002851.2-6259s21c1
Sequence:CCGGACGAAGGAACTGTCAACATATCTCGAGATATGTTGACAGTTCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002851.2-1796s21c1
Sequence:CCGGCAATCGCATAGGGACGAAATACTCGAGTATTTCGTCCCTATGCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002851.2-2200s21c1
Sequence:CCGGACATATCCCAAGGGTATATATCTCGAGATATATACCCTTGGGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002851.2-3306s21c1
Sequence:CCGGATACCTAAGTCTTCGTTAATACTCGAGTATTAACGAAGACTTAGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_358362
PTPRZ1 MISSION shRNA Bacterial Glycerol Stock
protein tyrosine phosphatase, receptor-type, Z polypeptide 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_358362.2-6780s1c1
Sequence:CCGGCGGCATTTATGTTACTTCTAACTCGAGTTAGAAGTAACATAAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358362.2-3570s1c1
Sequence:CCGGCTCTTGTTTATCCCACAACTACTCGAGTAGTTGTGGGATAAACAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358362.2-4599s1c1
Sequence:CCGGCCTATAGAGAATCCCGGGAAACTCGAGTTTCCCGGGATTCTCTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358362.2-543s1c1
Sequence:CCGGCAGTGGAAATAAATCTCACTACTCGAGTAGTGAGATTTATTTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358362.2-1849s1c1
Sequence:CCGGCTCCTTAAACAGTGGCTCTAACTCGAGTTAGAGCCACTGTTTAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_358362
PTPRZ1 MISSION shRNA shRNA Plasmid DNA
protein tyrosine phosphatase, receptor-type, Z polypeptide 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_358362.2-6780s1c1
Sequence:CCGGCGGCATTTATGTTACTTCTAACTCGAGTTAGAAGTAACATAAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358362.2-3570s1c1
Sequence:CCGGCTCTTGTTTATCCCACAACTACTCGAGTAGTTGTGGGATAAACAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358362.2-4599s1c1
Sequence:CCGGCCTATAGAGAATCCCGGGAAACTCGAGTTTCCCGGGATTCTCTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358362.2-543s1c1
Sequence:CCGGCAGTGGAAATAAATCTCACTACTCGAGTAGTGAGATTTATTTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358362.2-1849s1c1
Sequence:CCGGCTCCTTAAACAGTGGCTCTAACTCGAGTTAGAGCCACTGTTTAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_358362
PTPRZ1 MISSION shRNA Lentiviral Transduction Particles
protein tyrosine phosphatase, receptor-type, Z polypeptide 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_358362.2-6780s1c1
Sequence:CCGGCGGCATTTATGTTACTTCTAACTCGAGTTAGAAGTAACATAAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358362.2-3570s1c1
Sequence:CCGGCTCTTGTTTATCCCACAACTACTCGAGTAGTTGTGGGATAAACAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358362.2-4599s1c1
Sequence:CCGGCCTATAGAGAATCCCGGGAAACTCGAGTTTCCCGGGATTCTCTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358362.2-543s1c1
Sequence:CCGGCAGTGGAAATAAATCTCACTACTCGAGTAGTGAGATTTATTTCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358362.2-1849s1c1
Sequence:CCGGCTCCTTAAACAGTGGCTCTAACTCGAGTTAGAGCCACTGTTTAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks