EMAIL THIS PAGE TO A FRIEND

PURG

purine-rich element binding protein G

Synonyms: PURG-A PURG-B
UniProtKB ID: Q9UJV8, Q8TE64
Gene ID:
Human(29942) Summary: The exact function of this gene is not known, however, its encoded product is highly similar to purine-rich element binding protein A. The latter is a DNA-binding protein which binds preferentially to the single strand of the purine-rich element termed PUR, and has been implicated in the control of both DNA replication and transcription. This gene lies in close proximity to the Werner syndrome gene, but on the opposite strand, on chromosome 8p11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(75029) purine-rich element binding protein G
Rat(361162) purine-rich element binding protein G
Zebrafish(569414) purine-rich element binding protein G
dog(482870) purine-rich element binding protein G
Horse(100058191) purine-rich element binding protein G
domestic cat(101091015) purine-rich element binding protein G
chicken(428737) purine-rich element binding protein G
domestic guinea pig(100720995) purine-rich element binding protein G
naked mole-rat(101725070) purine-rich element binding protein G
cow(512941) purine-rich element binding protein G
sheep(101106306) purine-rich element binding protein G
217 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152821 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_152821 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_152821 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013357 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013357 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013357 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001015508 Rosetta Predictions human pricing
NM_013357 Rosetta Predictions human pricing
XM_001068166 Rosetta Predictions rat pricing
XM_341448 Rosetta Predictions rat pricing
NM_001098233 Rosetta Predictions mouse pricing
NM_152821 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015508 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306662 predicted 1572
2 SASI_Hs01_00221972 predicted 1461
3 SASI_Hs01_00221973 predicted 1512
4 SASI_Hs01_00221975 predicted 1444
5 SASI_Hs01_00221976 predicted 1469
6 SASI_Hs01_00221977 predicted 1467
7 SASI_Hs01_00221978 predicted 1196
8 SASI_Hs01_00221979 predicted 1222
9 SASI_Hs01_00221980 predicted 1313
10 SASI_Hs01_00221981 predicted 1468
11 SASI_Hs01_00221974 predicted 1318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344688 predicted 657
2 SASI_Hs01_00116320 predicted 547
3 SASI_Hs01_00116321 predicted 592
4 SASI_Hs01_00116323 predicted 529
5 SASI_Hs01_00116324 predicted 558
6 SASI_Hs01_00116325 predicted 560
7 SASI_Hs01_00116326 predicted 278
8 SASI_Hs01_00116327 predicted 305
9 SASI_Hs01_00116328 predicted 407
10 SASI_Hs01_00116329 predicted 553
11 SASI_Hs01_00116322 predicted 405
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068166 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323681 predicted 1761
2 SASI_Rn02_00323682 predicted 1603
3 SASI_Rn02_00323683 predicted 1723
4 SASI_Rn02_00323684 predicted 1967
5 SASI_Rn02_00323685 predicted 1592
6 SASI_Rn02_00323686 predicted 1349
7 SASI_Rn02_00323687 predicted 1429
8 SASI_Rn02_00323688 predicted 1785
9 SASI_Rn02_00323689 predicted 1887
10 SASI_Rn02_00323690 predicted 1469
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341448 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392942 predicted 358
2 SASI_Rn02_00392943 predicted 538
3 SASI_Rn02_00392944 predicted 539
4 SASI_Rn02_00392945 predicted 411
5 SASI_Rn02_00392946 predicted 357
6 SASI_Rn02_00392947 predicted 531
7 SASI_Rn02_00392948 predicted 1760
8 SASI_Rn02_00392949 predicted 37
9 SASI_Rn02_00392950 predicted 1158
10 SASI_Rn02_00392951 predicted 1606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098233 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301327 predicted 1033
2 SASI_Mm02_00301328 predicted 996
3 SASI_Mm02_00301329 predicted 985
4 SASI_Mm02_00301330 predicted 949
5 SASI_Mm02_00301331 predicted 889
6 SASI_Mm02_00301332 predicted 843
7 SASI_Mm02_00301333 predicted 598
8 SASI_Mm02_00301334 predicted 698
9 SASI_Mm02_00301335 predicted 532
10 SASI_Mm02_00301336 predicted 1009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152821 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096397 predicted 406
2 SASI_Mm01_00096398 predicted 685
3 SASI_Mm01_00096400 predicted 712
4 SASI_Mm02_00342828 predicted 852
5 SASI_Mm01_00096401 predicted 723
6 SASI_Mm01_00096402 predicted 773
7 SASI_Mm01_00096403 predicted 275
8 SASI_Mm01_00096404 predicted 203
9 SASI_Mm01_00096405 predicted 842
10 SASI_Mm01_00096406 predicted 599
11 SASI_Mm01_00096399 predicted 586
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152821
PURG MISSION shRNA Bacterial Glycerol Stock
purine-rich element binding protein G
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152821.1-696s1c1
Sequence:CCGGGCACAAGGTATGATTGAATTTCTCGAGAAATTCAATCATACCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152821.1-267s1c1
Sequence:CCGGCGCTTCCTAAAGATAGCCGAACTCGAGTTCGGCTATCTTTAGGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152821.1-601s1c1
Sequence:CCGGGCTTCCTAAGGATTAGACAAACTCGAGTTTGTCTAATCCTTAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152821.1-600s1c1
Sequence:CCGGCGCTTCCTAAGGATTAGACAACTCGAGTTGTCTAATCCTTAGGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152821.1-92s1c1
Sequence:CCGGCCTAAGCAAGAGTAGACTCTACTCGAGTAGAGTCTACTCTTGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152821
PURG MISSION shRNA shRNA Plasmid DNA
purine-rich element binding protein G
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152821.1-696s1c1
Sequence:CCGGGCACAAGGTATGATTGAATTTCTCGAGAAATTCAATCATACCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152821.1-267s1c1
Sequence:CCGGCGCTTCCTAAAGATAGCCGAACTCGAGTTCGGCTATCTTTAGGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152821.1-601s1c1
Sequence:CCGGGCTTCCTAAGGATTAGACAAACTCGAGTTTGTCTAATCCTTAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152821.1-600s1c1
Sequence:CCGGCGCTTCCTAAGGATTAGACAACTCGAGTTGTCTAATCCTTAGGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152821.1-92s1c1
Sequence:CCGGCCTAAGCAAGAGTAGACTCTACTCGAGTAGAGTCTACTCTTGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152821
PURG MISSION shRNA Lentiviral Transduction Particles
purine-rich element binding protein G
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152821.1-696s1c1
Sequence:CCGGGCACAAGGTATGATTGAATTTCTCGAGAAATTCAATCATACCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152821.1-267s1c1
Sequence:CCGGCGCTTCCTAAAGATAGCCGAACTCGAGTTCGGCTATCTTTAGGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152821.1-601s1c1
Sequence:CCGGGCTTCCTAAGGATTAGACAAACTCGAGTTTGTCTAATCCTTAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152821.1-600s1c1
Sequence:CCGGCGCTTCCTAAGGATTAGACAACTCGAGTTGTCTAATCCTTAGGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152821.1-92s1c1
Sequence:CCGGCCTAAGCAAGAGTAGACTCTACTCGAGTAGAGTCTACTCTTGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013357
PURG MISSION shRNA Bacterial Glycerol Stock
purine-rich element binding protein G
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013357.2-604s1c1
Sequence:CCGGCCTACGGATTAGACAAACCATCTCGAGATGGTTTGTCTAATCCGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013357.2-91s1c1
Sequence:CCGGCCTAAGCAAGAGTAGACTCTACTCGAGTAGAGTCTACTCTTGCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013357.2-600s1c1
Sequence:CCGGGCTTCCTACGGATTAGACAAACTCGAGTTTGTCTAATCCGTAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158650    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013357.2-1585s1c1
Sequence:CCGGCCATCAAAGGATCAAATCTTACTCGAGTAAGATTTGATCCTTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013357.2-550s1c1
Sequence:CCGGGAGGGACAATAGGAAATATTACTCGAGTAATATTTCCTATTGTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013357.2-695s1c1
Sequence:CCGGGCACAAGGAATGATTGAGTTTCTCGAGAAACTCAATCATTCCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159484    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013357.2-1808s1c1
Sequence:CCGGCCAAAGTTTCAGGAATTACTTCTCGAGAAGTAATTCCTGAAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160492    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013357.2-1762s1c1
Sequence:CCGGCCCTTCTTTACCTCTACTTAACTCGAGTTAAGTAGAGGTAAAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013357.2-1504s21c1
Sequence:CCGGGAAATTGACCTCCGGTATATACTCGAGTATATACCGGAGGTCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013357.2-1158s21c1
Sequence:CCGGGCCCGTTGTTATTAGTAATACCTCGAGGTATTACTAATAACAACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013357.2-894s21c1
Sequence:CCGGTGAGACCACCTTACCGTAATACTCGAGTATTACGGTAAGGTGGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013357.2-634s21c1
Sequence:CCGGGACTGGCATGATAGGTTATTTCTCGAGAAATAACCTATCATGCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013357
PURG MISSION shRNA shRNA Plasmid DNA
purine-rich element binding protein G
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013357.2-604s1c1
Sequence:CCGGCCTACGGATTAGACAAACCATCTCGAGATGGTTTGTCTAATCCGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013357.2-91s1c1
Sequence:CCGGCCTAAGCAAGAGTAGACTCTACTCGAGTAGAGTCTACTCTTGCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013357.2-600s1c1
Sequence:CCGGGCTTCCTACGGATTAGACAAACTCGAGTTTGTCTAATCCGTAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158650    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013357.2-1585s1c1
Sequence:CCGGCCATCAAAGGATCAAATCTTACTCGAGTAAGATTTGATCCTTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013357.2-550s1c1
Sequence:CCGGGAGGGACAATAGGAAATATTACTCGAGTAATATTTCCTATTGTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013357.2-695s1c1
Sequence:CCGGGCACAAGGAATGATTGAGTTTCTCGAGAAACTCAATCATTCCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159484    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013357.2-1808s1c1
Sequence:CCGGCCAAAGTTTCAGGAATTACTTCTCGAGAAGTAATTCCTGAAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160492    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013357.2-1762s1c1
Sequence:CCGGCCCTTCTTTACCTCTACTTAACTCGAGTTAAGTAGAGGTAAAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013357.2-1504s21c1
Sequence:CCGGGAAATTGACCTCCGGTATATACTCGAGTATATACCGGAGGTCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013357.2-1158s21c1
Sequence:CCGGGCCCGTTGTTATTAGTAATACCTCGAGGTATTACTAATAACAACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013357.2-894s21c1
Sequence:CCGGTGAGACCACCTTACCGTAATACTCGAGTATTACGGTAAGGTGGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013357.2-634s21c1
Sequence:CCGGGACTGGCATGATAGGTTATTTCTCGAGAAATAACCTATCATGCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013357
PURG MISSION shRNA Lentiviral Transduction Particles
purine-rich element binding protein G
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013357.2-604s1c1
Sequence:CCGGCCTACGGATTAGACAAACCATCTCGAGATGGTTTGTCTAATCCGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013357.2-91s1c1
Sequence:CCGGCCTAAGCAAGAGTAGACTCTACTCGAGTAGAGTCTACTCTTGCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013357.2-600s1c1
Sequence:CCGGGCTTCCTACGGATTAGACAAACTCGAGTTTGTCTAATCCGTAGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158650    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013357.2-1585s1c1
Sequence:CCGGCCATCAAAGGATCAAATCTTACTCGAGTAAGATTTGATCCTTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013357.2-550s1c1
Sequence:CCGGGAGGGACAATAGGAAATATTACTCGAGTAATATTTCCTATTGTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013357.2-695s1c1
Sequence:CCGGGCACAAGGAATGATTGAGTTTCTCGAGAAACTCAATCATTCCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159484    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013357.2-1808s1c1
Sequence:CCGGCCAAAGTTTCAGGAATTACTTCTCGAGAAGTAATTCCTGAAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160492    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013357.2-1762s1c1
Sequence:CCGGCCCTTCTTTACCTCTACTTAACTCGAGTTAAGTAGAGGTAAAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013357.2-1504s21c1
Sequence:CCGGGAAATTGACCTCCGGTATATACTCGAGTATATACCGGAGGTCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013357.2-1158s21c1
Sequence:CCGGGCCCGTTGTTATTAGTAATACCTCGAGGTATTACTAATAACAACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013357.2-894s21c1
Sequence:CCGGTGAGACCACCTTACCGTAATACTCGAGTATTACGGTAAGGTGGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013357.2-634s21c1
Sequence:CCGGGACTGGCATGATAGGTTATTTCTCGAGAAATAACCTATCATGCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks