EMAIL THIS PAGE TO A FRIEND

PUSL1

pseudouridylate synthase-like 1

UniProtKB ID: Q8N0Z8, B4DP76, Q5TA41
Gene ID:
Mouse(433813) pseudouridylate synthase-like 1
Rat(362681) pseudouridylate synthase-like 1
domestic guinea pig(100714616) pseudouridylate synthase-like 1
naked mole-rat(101717400) pseudouridylate synthase-like 1
cow(617640) pseudouridylate synthase-like 1
sheep(101105015) pseudouridylate synthase-like 1
chicken(419419) pseudouridylate synthase-like 1
domestic cat(101084271) pseudouridylate synthase-like 1
dog(489596) pseudouridylate synthase-like 1
Gene Class: Dehydratase
127 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153339 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153339 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153339 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033490 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033490 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033490 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153339 Rosetta Predictions human pricing
NM_001108699 Rosetta Predictions rat pricing
XM_001004394 Rosetta Predictions mouse pricing
XM_001004396 Rosetta Predictions mouse pricing
XM_001004400 Rosetta Predictions mouse pricing
XM_001004402 Rosetta Predictions mouse pricing
XM_001004405 Rosetta Predictions mouse pricing
XM_001004408 Rosetta Predictions mouse pricing
XM_001004412 Rosetta Predictions mouse pricing
XM_001476573 Rosetta Predictions mouse pricing
XM_001476588 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023311 predicted 933
2 SASI_Hs01_00023313 predicted 448
3 SASI_Hs01_00023314 predicted 545
4 SASI_Hs01_00023315 predicted 853
5 SASI_Hs01_00023316 predicted 845
6 SASI_Hs02_00367193 predicted 431
7 SASI_Hs02_00367194 predicted 448
8 SASI_Hs01_00023317 predicted 378
9 SASI_Hs01_00023318 predicted 378
10 SASI_Hs01_00023319 predicted 788
11 SASI_Hs01_00023310 predicted 937
12 SASI_Hs01_00023312 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108699 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241205 predicted 1437
2 SASI_Rn02_00241206 predicted 1217
3 SASI_Rn02_00241207 predicted 843
4 SASI_Rn02_00241208 predicted 1195
5 SASI_Rn02_00241209 predicted 1048
6 SASI_Rn02_00241210 predicted 842
7 SASI_Rn02_00241211 predicted 976
8 SASI_Rn02_00241212 predicted 977
9 SASI_Rn02_00241213 predicted 883
10 SASI_Rn02_00241214 predicted 1274
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004394 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00256349 predicted 207
2 SASI_Mm01_00256350 predicted 204
3 SASI_Mm01_00256351 predicted 206
4 SASI_Mm01_00256352 predicted 227
5 SASI_Mm01_00256353 predicted 213
6 SASI_Mm01_00256354 predicted 50
7 SASI_Mm01_00256355 predicted 296
8 SASI_Mm01_00256356 predicted 61
9 SASI_Mm01_00256357 predicted 54
10 SASI_Mm01_00256358 predicted 390
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004396 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245943 predicted 742
2 SASI_Mm01_00245944 predicted 1135
3 SASI_Mm01_00245945 predicted 350
4 SASI_Mm01_00245946 predicted 933
5 SASI_Mm01_00245947 predicted 778
6 SASI_Mm01_00245948 predicted 1047
7 SASI_Mm01_00245949 predicted 210
8 SASI_Mm01_00245950 predicted 1020
9 SASI_Mm01_00245951 predicted 1080
10 SASI_Mm01_00245952 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004400 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242542 predicted 849
2 SASI_Mm01_00242543 predicted 348
3 SASI_Mm01_00242544 predicted 674
4 SASI_Mm01_00242545 predicted 475
5 SASI_Mm01_00242546 predicted 212
6 SASI_Mm01_00242547 predicted 89
7 SASI_Mm01_00242548 predicted 709
8 SASI_Mm01_00242549 predicted 460
9 SASI_Mm01_00242550 predicted 652
10 SASI_Mm01_00242551 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004402 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215726 predicted 1136
2 SASI_Mm01_00215727 predicted 869
3 SASI_Mm01_00215728 predicted 900
4 SASI_Mm01_00215729 predicted 986
5 SASI_Mm01_00215730 predicted 831
6 SASI_Mm01_00215731 predicted 697
7 SASI_Mm01_00215732 predicted 984
8 SASI_Mm01_00215733 predicted 765
9 SASI_Mm01_00215734 predicted 857
10 SASI_Mm01_00215735 predicted 912
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004405 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273032 predicted 1320
2 SASI_Mm01_00273033 predicted 1051
3 SASI_Mm01_00273034 predicted 1078
4 SASI_Mm01_00273035 predicted 1169
5 SASI_Mm01_00273036 predicted 1023
6 SASI_Mm01_00273037 predicted 881
7 SASI_Mm01_00273038 predicted 1168
8 SASI_Mm01_00273039 predicted 945
9 SASI_Mm01_00273040 predicted 1047
10 SASI_Mm01_00273041 predicted 1103
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004408 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227462 predicted 1426
2 SASI_Mm01_00227463 predicted 1169
3 SASI_Mm01_00227464 predicted 1201
4 SASI_Mm01_00227465 predicted 1279
5 SASI_Mm01_00227466 predicted 1135
6 SASI_Mm01_00227467 predicted 1001
7 SASI_Mm01_00227468 predicted 1283
8 SASI_Mm01_00227469 predicted 1060
9 SASI_Mm01_00227470 predicted 1160
10 SASI_Mm01_00227471 predicted 1214
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004412 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00243470 predicted 1251
2 SASI_Mm01_00243471 predicted 985
3 SASI_Mm01_00243472 predicted 335
4 SASI_Mm01_00243473 predicted 1094
5 SASI_Mm01_00243474 predicted 951
6 SASI_Mm01_00243475 predicted 1099
7 SASI_Mm01_00243476 predicted 212
8 SASI_Mm01_00243477 predicted 977
9 SASI_Mm01_00243478 predicted 1031
10 SASI_Mm01_00243479 predicted 985
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001476573 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00389870 predicted 1251
2 SASI_Mm02_00389871 predicted 976
3 SASI_Mm02_00389872 predicted 338
4 SASI_Mm02_00389873 predicted 1098
5 SASI_Mm02_00389874 predicted 944
6 SASI_Mm02_00389875 predicted 206
7 SASI_Mm02_00389876 predicted 973
8 SASI_Mm02_00389877 predicted 1029
9 SASI_Mm02_00389878 predicted 981
10 SASI_Mm02_00389879 predicted 1249
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001476588 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00389963 predicted 1480
2 SASI_Mm02_00389964 predicted 1218
3 SASI_Mm02_00389965 predicted 500
4 SASI_Mm02_00389966 predicted 896
5 SASI_Mm02_00389967 predicted 1331
6 SASI_Mm02_00389968 predicted 1184
7 SASI_Mm02_00389969 predicted 371
8 SASI_Mm02_00389970 predicted 1208
9 SASI_Mm02_00389971 predicted 1267
10 SASI_Mm02_00389972 predicted 1218
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153339
VALIDATED
PUSL1 MISSION shRNA Bacterial Glycerol Stock
pseudouridylate synthase-like 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153339.1-703s1c1
Sequence:CCGGGAGAGCCAGTCTTTCCTGTATCTCGAGATACAGGAAAGACTGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153339.1-69s1c1
Sequence:CCGGCTATCTTGTGTACTTCCAGTACTCGAGTACTGGAAGTACACAAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153339.1-699s1c1
Sequence:CCGGGTTTGAGAGCCAGTCTTTCCTCTCGAGAGGAAAGACTGGCTCTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153339.1-66s1c1
Sequence:CCGGGCGCTATCTTGTGTACTTCCACTCGAGTGGAAGTACACAAGATAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153339.1-73s1c1
Sequence:CCGGCTTGTGTACTTCCAGTACGTGCTCGAGCACGTACTGGAAGTACACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153339.1-855s1c1
Sequence:CCGGCGGCTTATTCCTCAAGTCAGTCTCGAGACTGACTTGAGGAATAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_153339.1-465s21c1
Sequence:CCGGGGTGTTTGAACGCAACCTATGCTCGAGCATAGGTTGCGTTCAAACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_153339.1-947s21c1
Sequence:CCGGGGACACTCAAGCCAAAGTTAGCTCGAGCTAACTTTGGCTTGAGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_153339.1-66s21c1
Sequence:CCGGGCGCTATCTTGTGTACTTCCACTCGAGTGGAAGTACACAAGATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_153339.1-699s21c1
Sequence:CCGGGTTTGAGAGCCAGTCTTTCCTCTCGAGAGGAAAGACTGGCTCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_153339.1-855s21c1
Sequence:CCGGCGGCTTATTCCTCAAGTCAGTCTCGAGACTGACTTGAGGAATAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153339
VALIDATED
PUSL1 MISSION shRNA shRNA Plasmid DNA
pseudouridylate synthase-like 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153339.1-703s1c1
Sequence:CCGGGAGAGCCAGTCTTTCCTGTATCTCGAGATACAGGAAAGACTGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153339.1-69s1c1
Sequence:CCGGCTATCTTGTGTACTTCCAGTACTCGAGTACTGGAAGTACACAAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153339.1-699s1c1
Sequence:CCGGGTTTGAGAGCCAGTCTTTCCTCTCGAGAGGAAAGACTGGCTCTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153339.1-66s1c1
Sequence:CCGGGCGCTATCTTGTGTACTTCCACTCGAGTGGAAGTACACAAGATAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153339.1-73s1c1
Sequence:CCGGCTTGTGTACTTCCAGTACGTGCTCGAGCACGTACTGGAAGTACACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153339.1-855s1c1
Sequence:CCGGCGGCTTATTCCTCAAGTCAGTCTCGAGACTGACTTGAGGAATAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_153339.1-465s21c1
Sequence:CCGGGGTGTTTGAACGCAACCTATGCTCGAGCATAGGTTGCGTTCAAACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_153339.1-947s21c1
Sequence:CCGGGGACACTCAAGCCAAAGTTAGCTCGAGCTAACTTTGGCTTGAGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_153339.1-66s21c1
Sequence:CCGGGCGCTATCTTGTGTACTTCCACTCGAGTGGAAGTACACAAGATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_153339.1-699s21c1
Sequence:CCGGGTTTGAGAGCCAGTCTTTCCTCTCGAGAGGAAAGACTGGCTCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_153339.1-855s21c1
Sequence:CCGGCGGCTTATTCCTCAAGTCAGTCTCGAGACTGACTTGAGGAATAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153339
VALIDATED
PUSL1 MISSION shRNA Lentiviral Transduction Particles
pseudouridylate synthase-like 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155540    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153339.1-703s1c1
Sequence:CCGGGAGAGCCAGTCTTTCCTGTATCTCGAGATACAGGAAAGACTGGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153339.1-69s1c1
Sequence:CCGGCTATCTTGTGTACTTCCAGTACTCGAGTACTGGAAGTACACAAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153339.1-699s1c1
Sequence:CCGGGTTTGAGAGCCAGTCTTTCCTCTCGAGAGGAAAGACTGGCTCTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153339.1-66s1c1
Sequence:CCGGGCGCTATCTTGTGTACTTCCACTCGAGTGGAAGTACACAAGATAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153339.1-73s1c1
Sequence:CCGGCTTGTGTACTTCCAGTACGTGCTCGAGCACGTACTGGAAGTACACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153339.1-855s1c1
Sequence:CCGGCGGCTTATTCCTCAAGTCAGTCTCGAGACTGACTTGAGGAATAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_153339.1-465s21c1
Sequence:CCGGGGTGTTTGAACGCAACCTATGCTCGAGCATAGGTTGCGTTCAAACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_153339.1-947s21c1
Sequence:CCGGGGACACTCAAGCCAAAGTTAGCTCGAGCTAACTTTGGCTTGAGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_153339.1-66s21c1
Sequence:CCGGGCGCTATCTTGTGTACTTCCACTCGAGTGGAAGTACACAAGATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_153339.1-699s21c1
Sequence:CCGGGTTTGAGAGCCAGTCTTTCCTCTCGAGAGGAAAGACTGGCTCTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_153339.1-855s21c1
Sequence:CCGGCGGCTTATTCCTCAAGTCAGTCTCGAGACTGACTTGAGGAATAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033490
PUSL1 MISSION shRNA Bacterial Glycerol Stock
pseudouridylate synthase-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033490.1-975s21c1
Sequence:CCGGGTGGAGATGAAGTGGAGATTGCTCGAGCAATCTCCACTTCATCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033490.1-722s21c1
Sequence:CCGGGAGTTTGAGAGCCAGTCTTTCCTCGAGGAAAGACTGGCTCTCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033490.1-568s21c1
Sequence:CCGGCCTCCTCGGGACACATGATTTCTCGAGAAATCATGTGTCCCGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033490.1-801s21c1
Sequence:CCGGTGGCACCCACACAAGTGAAAGCTCGAGCTTTCACTTGTGTGGGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033490.1-114s21c1
Sequence:CCGGACTTGGGCACTGACTTCAATGCTCGAGCATTGAAGTCAGTGCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033490
PUSL1 MISSION shRNA shRNA Plasmid DNA
pseudouridylate synthase-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033490.1-975s21c1
Sequence:CCGGGTGGAGATGAAGTGGAGATTGCTCGAGCAATCTCCACTTCATCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033490.1-722s21c1
Sequence:CCGGGAGTTTGAGAGCCAGTCTTTCCTCGAGGAAAGACTGGCTCTCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033490.1-568s21c1
Sequence:CCGGCCTCCTCGGGACACATGATTTCTCGAGAAATCATGTGTCCCGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033490.1-801s21c1
Sequence:CCGGTGGCACCCACACAAGTGAAAGCTCGAGCTTTCACTTGTGTGGGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033490.1-114s21c1
Sequence:CCGGACTTGGGCACTGACTTCAATGCTCGAGCATTGAAGTCAGTGCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033490
PUSL1 MISSION shRNA Lentiviral Transduction Particles
pseudouridylate synthase-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033490.1-975s21c1
Sequence:CCGGGTGGAGATGAAGTGGAGATTGCTCGAGCAATCTCCACTTCATCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033490.1-722s21c1
Sequence:CCGGGAGTTTGAGAGCCAGTCTTTCCTCGAGGAAAGACTGGCTCTCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033490.1-568s21c1
Sequence:CCGGCCTCCTCGGGACACATGATTTCTCGAGAAATCATGTGTCCCGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033490.1-801s21c1
Sequence:CCGGTGGCACCCACACAAGTGAAAGCTCGAGCTTTCACTTGTGTGGGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033490.1-114s21c1
Sequence:CCGGACTTGGGCACTGACTTCAATGCTCGAGCATTGAAGTCAGTGCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks