EMAIL THIS PAGE TO A FRIEND

PXN

paxillin

Gene ID:
Human(5829) Summary: This gene encodes a cytoskeletal protein involved in actin-membrane attachment at sites of cell adhesion to the extracellular matrix (focal adhesion). Alternatively spliced transcript variants encoding different isoforms have been described for this gene. These isoforms exhibit different expression pattern, and have different biochemical, as well as physiological properties (PMID:9054445). [provided by RefSeq, Aug 2011]
Mouse(19303) paxillin
Rat(360820) paxillin
fruit fly(38326) Peroxidasin
chicken(395832) paxillin
Horse(100053811) paxillin
dog(486299) paxillin
cow(517456) paxillin
sheep(101111491) paxillin
Gene Class: Cytoskeleton
125 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502553 Anti-Paxillin antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
SAB4502554 Anti-Paxillin, N-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB4301332 Anti-phospho-Paxillin (pSer178) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4301321 Anti-phospho-Paxillin (pSer272) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4504511 Anti-phospho-Paxillin (pTyr118) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
P6368 Anti-phospho-Paxillin (pTyr31) antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human
immunocytochemistry, western blot pricing
SAB4504512 Anti-phospho-Paxillin (pTyr31) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4300070 Anti-phospho-PXN (pTyr118) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
SAB4300161 Anti-phospho-PXN (pTyr31) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4300276 Anti-phospho-PXN (pTyr88) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, western blot pricing
SAB4300384 Anti-PXN (Ab-118) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB4300459 Anti-PXN (Ab-31) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4300592 Anti-PXN (Ab-88) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, western blot pricing
SAB1406355 Anti-PXN antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA051309 Anti-PXN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
P1093 Monoclonal Anti-Paxillin antibody produced in mouse clone PXC-10, ascites fluid hamster, human, bovine, chicken, rat
immunocytochemistry, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002859 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002859 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002859 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133915 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133915 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133915 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080855 Rosetta Predictions human pricing
NM_002859 Rosetta Predictions human pricing
NM_025157 Rosetta Predictions human pricing
NM_001012147 Rosetta Predictions rat pricing
XM_573409 Rosetta Predictions rat pricing
NM_011223 Rosetta Predictions mouse pricing
NM_133915 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316157 predicted 2220
2 SASI_Hs02_00316158 predicted 2317
3 SASI_Hs02_00316159 predicted 1958
4 SASI_Hs02_00316160 predicted 2217
5 SASI_Hs02_00316161 predicted 1267
6 SASI_Hs02_00316162 predicted 1513
7 SASI_Hs02_00316163 predicted 1850
8 SASI_Hs02_00316164 predicted 1289
9 SASI_Hs02_00316165 predicted 494
10 SASI_Hs02_00316166 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002859 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334622 predicted 2118
2 SASI_Hs01_00070404 predicted 2218
3 SASI_Hs01_00070405 predicted 1854
4 SASI_Hs01_00070406 predicted 2120
5 SASI_Hs01_00070408 predicted 1165
6 SASI_Hs02_00334623 predicted 1410
7 SASI_Hs01_00070409 predicted 1750
8 SASI_Hs01_00070411 predicted 1194
9 SASI_Hs01_00070412 predicted 499
10 SASI_Hs02_00334624 predicted 512
11 SASI_Hs01_00070403 predicted 2218
12 SASI_Hs01_00070407 predicted 1485
13 SASI_Hs01_00070410 predicted 1594
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025157 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357900 predicted 2248
2 SASI_Hs02_00357901 predicted 2349
3 SASI_Hs02_00357902 predicted 2338
4 SASI_Hs02_00357903 predicted 1984
5 SASI_Hs02_00357904 predicted 2248
6 SASI_Hs02_00357905 predicted 1296
7 SASI_Hs02_00357906 predicted 1536
8 SASI_Hs02_00357907 predicted 1878
9 SASI_Hs02_00357908 predicted 1319
10 SASI_Hs02_00357909 predicted 1543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012147 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074476 predicted 1270
2 SASI_Rn01_00074478 predicted 1290
3 SASI_Rn02_00200324 predicted 815
4 SASI_Rn01_00074479 predicted 254
5 SASI_Rn01_00074480 predicted 1194
6 SASI_Rn01_00074481 predicted 1795
7 SASI_Rn01_00074482 predicted 631
8 SASI_Rn01_00074484 predicted 944
9 SASI_Rn01_00074485 predicted 1529
10 SASI_Rn02_00200325 predicted 1305
11 SASI_Rn01_00074477 predicted 1687
12 SASI_Rn01_00074483 predicted 1307
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573409 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00175297 predicted 1491
2 SASI_Rn01_00175298 predicted 316
3 SASI_Rn01_00175299 predicted 2068
4 SASI_Rn01_00175300 predicted 1833
5 SASI_Rn01_00175301 predicted 1499
6 SASI_Rn01_00175302 predicted 1500
7 SASI_Rn01_00175303 predicted 221
8 SASI_Rn01_00175304 predicted 1483
9 SASI_Rn01_00175305 predicted 1818
10 SASI_Rn01_00175306 predicted 1870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011223 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136923 predicted 1437
2 SASI_Mm01_00136925 predicted 1189
3 SASI_Mm02_00320178 predicted 1777
4 SASI_Mm02_00320179 predicted 1685
5 SASI_Mm01_00136927 predicted 1212
6 SASI_Mm02_00320180 predicted 241
7 SASI_Mm01_00136928 predicted 1308
8 SASI_Mm01_00136930 predicted 1421
9 SASI_Mm02_00320181 predicted 1972
10 SASI_Mm02_00320182 predicted 1669
11 SASI_Mm01_00136924 predicted 1380
12 SASI_Mm01_00136926 predicted 1216
13 SASI_Mm01_00136929 predicted 368
14 SASI_Mm01_00136931 predicted 1287
15 SASI_Mm01_00136932 predicted 522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133915 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038932 predicted 1537
2 SASI_Mm01_00038934 predicted 1287
3 SASI_Mm02_00338984 predicted 1879
4 SASI_Mm02_00338985 predicted 1782
5 SASI_Mm01_00038936 predicted 1316
6 SASI_Mm02_00338986 predicted 243
7 SASI_Mm01_00038937 predicted 1417
8 SASI_Mm01_00038939 predicted 1522
9 SASI_Mm02_00338987 predicted 2073
10 SASI_Mm02_00338988 predicted 1769
11 SASI_Mm01_00038933 predicted 1382
12 SASI_Mm01_00038935 predicted 1213
13 SASI_Mm01_00038938 predicted 261
14 SASI_Mm01_00038940 predicted 1289
15 SASI_Mm01_00038941 predicted 413
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002859
VALIDATED
PXN MISSION shRNA Bacterial Glycerol Stock
paxillin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123134    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002859.1-2161s1c1
Sequence:CCGGCCCGACCTAATTGTCTTTGTTCTCGAGAACAAAGACAATTAGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002859.1-662s1c1
Sequence:CCGGCCTGACGAAAGAGAAGCCTAACTCGAGTTAGGCTTCTCTTTCGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002859.1-173s1c1
Sequence:CCGGCCCAACTGGAAACCACACATACTCGAGTATGTGTGGTTTCCAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002859.1-172s1c1
Sequence:CCGGACCCAACTGGAAACCACACATCTCGAGATGTGTGGTTTCCAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002859.1-1709s1c1
Sequence:CCGGGCCTTACTGTCAGAACTGCTTCTCGAGAAGCAGTTCTGACAGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002859.2-512s21c1
Sequence:CCGGTGAGCCTTCACCCACCGTAATCTCGAGATTACGGTGGGTGAAGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002859.2-1766s21c1
Sequence:CCGGGCCTTACTGTCAGAACTGCTTCTCGAGAAGCAGTTCTGACAGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002859.2-229s21c1
Sequence:CCGGACCCAACTGGAAACCACACATCTCGAGATGTGTGGTTTCCAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002859.2-2218s21c1
Sequence:CCGGCCCGACCTAATTGTCTTTGTTCTCGAGAACAAAGACAATTAGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002859.2-1472s21c1
Sequence:CCGGGGCCATCCTGGAGAACTATATCTCGAGATATAGTTCTCCAGGATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002859
VALIDATED
PXN MISSION shRNA shRNA Plasmid DNA
paxillin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123134    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002859.1-2161s1c1
Sequence:CCGGCCCGACCTAATTGTCTTTGTTCTCGAGAACAAAGACAATTAGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002859.1-662s1c1
Sequence:CCGGCCTGACGAAAGAGAAGCCTAACTCGAGTTAGGCTTCTCTTTCGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002859.1-173s1c1
Sequence:CCGGCCCAACTGGAAACCACACATACTCGAGTATGTGTGGTTTCCAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002859.1-172s1c1
Sequence:CCGGACCCAACTGGAAACCACACATCTCGAGATGTGTGGTTTCCAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002859.1-1709s1c1
Sequence:CCGGGCCTTACTGTCAGAACTGCTTCTCGAGAAGCAGTTCTGACAGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002859.2-512s21c1
Sequence:CCGGTGAGCCTTCACCCACCGTAATCTCGAGATTACGGTGGGTGAAGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002859.2-1766s21c1
Sequence:CCGGGCCTTACTGTCAGAACTGCTTCTCGAGAAGCAGTTCTGACAGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002859.2-229s21c1
Sequence:CCGGACCCAACTGGAAACCACACATCTCGAGATGTGTGGTTTCCAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002859.2-2218s21c1
Sequence:CCGGCCCGACCTAATTGTCTTTGTTCTCGAGAACAAAGACAATTAGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002859.2-1472s21c1
Sequence:CCGGGGCCATCCTGGAGAACTATATCTCGAGATATAGTTCTCCAGGATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002859
VALIDATED
PXN MISSION shRNA Lentiviral Transduction Particles
paxillin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123134    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002859.1-2161s1c1
Sequence:CCGGCCCGACCTAATTGTCTTTGTTCTCGAGAACAAAGACAATTAGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002859.1-662s1c1
Sequence:CCGGCCTGACGAAAGAGAAGCCTAACTCGAGTTAGGCTTCTCTTTCGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002859.1-173s1c1
Sequence:CCGGCCCAACTGGAAACCACACATACTCGAGTATGTGTGGTTTCCAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002859.1-172s1c1
Sequence:CCGGACCCAACTGGAAACCACACATCTCGAGATGTGTGGTTTCCAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002859.1-1709s1c1
Sequence:CCGGGCCTTACTGTCAGAACTGCTTCTCGAGAAGCAGTTCTGACAGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002859.2-512s21c1
Sequence:CCGGTGAGCCTTCACCCACCGTAATCTCGAGATTACGGTGGGTGAAGGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002859.2-1766s21c1
Sequence:CCGGGCCTTACTGTCAGAACTGCTTCTCGAGAAGCAGTTCTGACAGTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002859.2-229s21c1
Sequence:CCGGACCCAACTGGAAACCACACATCTCGAGATGTGTGGTTTCCAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002859.2-2218s21c1
Sequence:CCGGCCCGACCTAATTGTCTTTGTTCTCGAGAACAAAGACAATTAGGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002859.2-1472s21c1
Sequence:CCGGGGCCATCCTGGAGAACTATATCTCGAGATATAGTTCTCCAGGATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133915
VALIDATED
PXN MISSION shRNA Bacterial Glycerol Stock
paxillin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133915.1-1455s1c1
Sequence:CCGGGAACTACATTTCAGCCCTCAACTCGAGTTGAGGGCTGAAATGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133915.1-427s1c1
Sequence:CCGGTCTGAACTTGACCGGCTGTTACTCGAGTAACAGCCGGTCAAGTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133915.1-90s1c1
Sequence:CCGGCTACTCCTACCCAACTGGAAACTCGAGTTTCCAGTTGGGTAGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133915.1-194s1c1
Sequence:CCGGCTTTAGATCAGTGGCAGCCTACTCGAGTAGGCTGCCACTGATCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133915.1-1392s1c1
Sequence:CCGGTCGTAAAGATTACTTCGACATCTCGAGATGTCGAAGTAATCTTTACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133915.2-1416s21c1
Sequence:CCGGACGGACCCATCCTGGATAAAGCTCGAGCTTTATCCAGGATGGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133915.2-1609s21c1
Sequence:CCGGGAACTACATTTCAGCCCTCAACTCGAGTTGAGGGCTGAAATGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133915.2-1546s21c1
Sequence:CCGGTCGTAAAGATTACTTCGACATCTCGAGATGTCGAAGTAATCTTTACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133915.2-581s21c1
Sequence:CCGGTCTGAACTTGACCGGCTGTTACTCGAGTAACAGCCGGTCAAGTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133915.2-2331s21c1
Sequence:CCGGACTAGACAATGCCAGCATAAACTCGAGTTTATGCTGGCATTGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133915
VALIDATED
PXN MISSION shRNA shRNA Plasmid DNA
paxillin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133915.1-1455s1c1
Sequence:CCGGGAACTACATTTCAGCCCTCAACTCGAGTTGAGGGCTGAAATGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133915.1-427s1c1
Sequence:CCGGTCTGAACTTGACCGGCTGTTACTCGAGTAACAGCCGGTCAAGTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133915.1-90s1c1
Sequence:CCGGCTACTCCTACCCAACTGGAAACTCGAGTTTCCAGTTGGGTAGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133915.1-194s1c1
Sequence:CCGGCTTTAGATCAGTGGCAGCCTACTCGAGTAGGCTGCCACTGATCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133915.1-1392s1c1
Sequence:CCGGTCGTAAAGATTACTTCGACATCTCGAGATGTCGAAGTAATCTTTACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133915.2-1416s21c1
Sequence:CCGGACGGACCCATCCTGGATAAAGCTCGAGCTTTATCCAGGATGGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133915.2-1609s21c1
Sequence:CCGGGAACTACATTTCAGCCCTCAACTCGAGTTGAGGGCTGAAATGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133915.2-1546s21c1
Sequence:CCGGTCGTAAAGATTACTTCGACATCTCGAGATGTCGAAGTAATCTTTACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133915.2-581s21c1
Sequence:CCGGTCTGAACTTGACCGGCTGTTACTCGAGTAACAGCCGGTCAAGTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133915.2-2331s21c1
Sequence:CCGGACTAGACAATGCCAGCATAAACTCGAGTTTATGCTGGCATTGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133915
VALIDATED
PXN MISSION shRNA Lentiviral Transduction Particles
paxillin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133915.1-1455s1c1
Sequence:CCGGGAACTACATTTCAGCCCTCAACTCGAGTTGAGGGCTGAAATGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133915.1-427s1c1
Sequence:CCGGTCTGAACTTGACCGGCTGTTACTCGAGTAACAGCCGGTCAAGTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133915.1-90s1c1
Sequence:CCGGCTACTCCTACCCAACTGGAAACTCGAGTTTCCAGTTGGGTAGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133915.1-194s1c1
Sequence:CCGGCTTTAGATCAGTGGCAGCCTACTCGAGTAGGCTGCCACTGATCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133915.1-1392s1c1
Sequence:CCGGTCGTAAAGATTACTTCGACATCTCGAGATGTCGAAGTAATCTTTACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133915.2-1416s21c1
Sequence:CCGGACGGACCCATCCTGGATAAAGCTCGAGCTTTATCCAGGATGGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133915.2-1609s21c1
Sequence:CCGGGAACTACATTTCAGCCCTCAACTCGAGTTGAGGGCTGAAATGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133915.2-1546s21c1
Sequence:CCGGTCGTAAAGATTACTTCGACATCTCGAGATGTCGAAGTAATCTTTACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133915.2-581s21c1
Sequence:CCGGTCTGAACTTGACCGGCTGTTACTCGAGTAACAGCCGGTCAAGTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133915.2-2331s21c1
Sequence:CCGGACTAGACAATGCCAGCATAAACTCGAGTTTATGCTGGCATTGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks