EMAIL THIS PAGE TO A FRIEND

PYGB

phosphorylase, glycogen; brain

Synonyms: GPBB
UniProtKB ID: P11216, Q96AK1, Q9NPX8
Gene ID:
Human(5834) Summary: The protein encoded by this gene is a glycogen phosphorylase found predominantly in the brain. The encoded protein forms homodimers which can associate into homotetramers, the enzymatically active form of glycogen phosphorylase. The activity of this enzyme is positively regulated by AMP and negatively regulated by ATP, ADP, and glucose-6-phosphate. This enzyme catalyzes the rate-determining step in glycogen degradation. [provided by RefSeq, Jul 2008]
Mouse(110078) brain glycogen phosphorylase
Rat(25739) phosphorylase, glycogen; brain
Zebrafish(403051) phosphorylase, glycogen; brain
dog(477003) phosphorylase, glycogen; brain
Horse(100057085) phosphorylase, glycogen; brain
domestic cat(101091099) phosphorylase, glycogen; brain
chicken(421248) phosphorylase, glycogen; brain
cow(505560) phosphorylase, glycogen; brain
sheep(554325) phosphorylase, glycogen; brain
naked mole-rat(101717341) phosphorylase, glycogen; brain
domestic guinea pig(100730114) phosphorylase, glycogen; brain
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101920 Anti-PYGB (ab1) antibody produced in rabbit affinity isolated antibody human, mouse, guinea pig, horse, bovine, rabbit, rat, pig, sheep, rabbit
western blot pricing
SAB2900042 Anti-PYGB (AB1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB2101921 Anti-PYGB (ab2) antibody produced in rabbit affinity isolated antibody zebrafish, rabbit, rat, bovine, mouse, guinea pig, horse, sheep, pig, human, rabbit
western blot pricing
SAB2900066 Anti-PYGB (AB2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rabbit, rat, Drosophila, hamster, pig, monkey, zebrafish, sheep, Xenopus, chicken, bovine, mouse, human
immunohistochemistry pricing
SAB2701629 Anti-pygb antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2701753 Anti-pygb antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
HPA031067 Anti-PYGB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1300548 Anti-PYGM (center) antibody produced in rabbit Ig fraction of antiserum, buffered aqueous solution human
ELISA, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
D1542 1,4-Dideoxy-1,4-imino-D-arabinitol hydrochloride enzyme inhibitor human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002862 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002862 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002862 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153781 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153781 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153781 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002862 Rosetta Predictions human pricing
NM_013188 Rosetta Predictions rat pricing
NM_153781 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194754 predicted 1074
2 SASI_Hs01_00194755 predicted 874
3 SASI_Hs01_00194756 predicted 1210
4 SASI_Hs01_00194757 predicted 2425
5 SASI_Hs01_00194758 predicted 573
6 SASI_Hs01_00194759 predicted 1079
7 SASI_Hs01_00194760 predicted 797
8 SASI_Hs01_00194761 predicted 1495
9 SASI_Hs01_00194762 predicted 1943
10 SASI_Hs02_00334632 predicted 1858
11 SASI_Hs01_00194753 predicted 696
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013188 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261024 predicted 2373
2 SASI_Rn02_00261025 predicted 2044
3 SASI_Rn02_00261026 predicted 1982
4 SASI_Rn02_00261027 predicted 955
5 SASI_Rn02_00261028 predicted 2423
6 SASI_Rn02_00261029 predicted 1985
7 SASI_Rn02_00261030 predicted 354
8 SASI_Rn02_00261031 predicted 577
9 SASI_Rn02_00261032 predicted 1189
10 SASI_Rn02_00261033 predicted 1086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153781 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088246 predicted 537
2 SASI_Mm02_00343503 predicted 989
3 SASI_Mm01_00088247 predicted 2009
4 SASI_Mm01_00088248 predicted 1946
5 SASI_Mm01_00088249 predicted 901
6 SASI_Mm01_00088250 predicted 1945
7 SASI_Mm02_00343504 predicted 2387
8 SASI_Mm01_00088251 predicted 779
9 SASI_Mm01_00088252 predicted 765
10 SASI_Mm01_00088253 predicted 2432
11 SASI_Mm01_00088254 predicted 1771
12 SASI_Mm01_00088255 predicted 1060
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002862
VALIDATED
PYGB MISSION shRNA Bacterial Glycerol Stock
phosphorylase, glycogen; brain
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002862.3-1495s21c1
Sequence:CCGGGATCGTGAAACAGTCGGTCTTCTCGAGAAGACCGACTGTTTCACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002862.3-579s21c1
Sequence:CCGGGCTATGGAATCCGCTATGAATCTCGAGATTCATAGCGGATTCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002862.3-1213s21c1
Sequence:CCGGCACGAAGAAGACCTGTGCATACTCGAGTATGCACAGGTCTTCTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002862.3-2949s21c1
Sequence:CCGGCCAGAACTTTGCACACATCTTCTCGAGAAGATGTGTGCAAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002862.3-2506s1c1
Sequence:CCGGCAAGAAGGTCATCAGGAACATCTCGAGATGTTCCTGATGACCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153652    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002862.3-2949s1c1
Sequence:CCGGCCAGAACTTTGCACACATCTTCTCGAGAAGATGTGTGCAAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002862.3-1717s1c1
Sequence:CCGGCAAGGTCAAACAGGAGAACAACTCGAGTTGTTCTCCTGTTTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002862.3-579s1c1
Sequence:CCGGGCTATGGAATCCGCTATGAATCTCGAGATTCATAGCGGATTCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002862.3-1498s1c1
Sequence:CCGGCGTGAAACAGTCGGTCTTTAACTCGAGTTAAAGACCGACTGTTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002862.3-1213s1c1
Sequence:CCGGCACGAAGAAGACCTGTGCATACTCGAGTATGCACAGGTCTTCTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002862.3-1495s1c1
Sequence:CCGGGATCGTGAAACAGTCGGTCTTCTCGAGAAGACCGACTGTTTCACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002862.3-2396s1c1
Sequence:CCGGGTGAACATGCTGATGCACCATCTCGAGATGGTGCATCAGCATGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002862
VALIDATED
PYGB MISSION shRNA shRNA Plasmid DNA
phosphorylase, glycogen; brain
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002862.3-1495s21c1
Sequence:CCGGGATCGTGAAACAGTCGGTCTTCTCGAGAAGACCGACTGTTTCACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002862.3-579s21c1
Sequence:CCGGGCTATGGAATCCGCTATGAATCTCGAGATTCATAGCGGATTCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002862.3-1213s21c1
Sequence:CCGGCACGAAGAAGACCTGTGCATACTCGAGTATGCACAGGTCTTCTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002862.3-2949s21c1
Sequence:CCGGCCAGAACTTTGCACACATCTTCTCGAGAAGATGTGTGCAAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002862.3-2506s1c1
Sequence:CCGGCAAGAAGGTCATCAGGAACATCTCGAGATGTTCCTGATGACCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153652    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002862.3-2949s1c1
Sequence:CCGGCCAGAACTTTGCACACATCTTCTCGAGAAGATGTGTGCAAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002862.3-1717s1c1
Sequence:CCGGCAAGGTCAAACAGGAGAACAACTCGAGTTGTTCTCCTGTTTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002862.3-579s1c1
Sequence:CCGGGCTATGGAATCCGCTATGAATCTCGAGATTCATAGCGGATTCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002862.3-1498s1c1
Sequence:CCGGCGTGAAACAGTCGGTCTTTAACTCGAGTTAAAGACCGACTGTTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002862.3-1213s1c1
Sequence:CCGGCACGAAGAAGACCTGTGCATACTCGAGTATGCACAGGTCTTCTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002862.3-1495s1c1
Sequence:CCGGGATCGTGAAACAGTCGGTCTTCTCGAGAAGACCGACTGTTTCACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002862.3-2396s1c1
Sequence:CCGGGTGAACATGCTGATGCACCATCTCGAGATGGTGCATCAGCATGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002862
VALIDATED
PYGB MISSION shRNA Lentiviral Transduction Particles
phosphorylase, glycogen; brain
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002862.3-1495s21c1
Sequence:CCGGGATCGTGAAACAGTCGGTCTTCTCGAGAAGACCGACTGTTTCACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002862.3-579s21c1
Sequence:CCGGGCTATGGAATCCGCTATGAATCTCGAGATTCATAGCGGATTCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002862.3-1213s21c1
Sequence:CCGGCACGAAGAAGACCTGTGCATACTCGAGTATGCACAGGTCTTCTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002862.3-2949s21c1
Sequence:CCGGCCAGAACTTTGCACACATCTTCTCGAGAAGATGTGTGCAAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002862.3-2506s1c1
Sequence:CCGGCAAGAAGGTCATCAGGAACATCTCGAGATGTTCCTGATGACCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153652    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002862.3-2949s1c1
Sequence:CCGGCCAGAACTTTGCACACATCTTCTCGAGAAGATGTGTGCAAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002862.3-1717s1c1
Sequence:CCGGCAAGGTCAAACAGGAGAACAACTCGAGTTGTTCTCCTGTTTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002862.3-579s1c1
Sequence:CCGGGCTATGGAATCCGCTATGAATCTCGAGATTCATAGCGGATTCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002862.3-1498s1c1
Sequence:CCGGCGTGAAACAGTCGGTCTTTAACTCGAGTTAAAGACCGACTGTTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002862.3-1213s1c1
Sequence:CCGGCACGAAGAAGACCTGTGCATACTCGAGTATGCACAGGTCTTCTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002862.3-1495s1c1
Sequence:CCGGGATCGTGAAACAGTCGGTCTTCTCGAGAAGACCGACTGTTTCACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157576    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002862.3-2396s1c1
Sequence:CCGGGTGAACATGCTGATGCACCATCTCGAGATGGTGCATCAGCATGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153781
VALIDATED
PYGB MISSION shRNA Bacterial Glycerol Stock
phosphorylase, glycogen; brain
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153781.1-2377s21c1
Sequence:CCGGCACGACAGATTCAAGGTATTTCTCGAGAAATACCTTGAATCTGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153781.1-1826s21c1
Sequence:CCGGTCACCCTGTACAACCGAATAACTCGAGTTATTCGGTTGTACAGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153781.1-538s21c1
Sequence:CCGGTACGGCTATGGAATCCGATATCTCGAGATATCGGATTCCATAGCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153781.1-281s21c1
Sequence:CCGGGCACGCAGCAGCATTACTATGCTCGAGCATAGTAATGCTGCTGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153781.1-3385s21c1
Sequence:CCGGTCTGCTAGGCTGACGACTAAGCTCGAGCTTAGTCGTCAGCCTAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153781.1-164s1c1
Sequence:CCGGGCTTCAACAGACACCTGCATTCTCGAGAATGCAGGTGTCTGTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153781.1-2019s1c1
Sequence:CCGGCCGTGTGTCTTTAGCTGAGAACTCGAGTTCTCAGCTAAAGACACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153781
VALIDATED
PYGB MISSION shRNA shRNA Plasmid DNA
phosphorylase, glycogen; brain
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153781.1-2377s21c1
Sequence:CCGGCACGACAGATTCAAGGTATTTCTCGAGAAATACCTTGAATCTGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153781.1-1826s21c1
Sequence:CCGGTCACCCTGTACAACCGAATAACTCGAGTTATTCGGTTGTACAGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153781.1-538s21c1
Sequence:CCGGTACGGCTATGGAATCCGATATCTCGAGATATCGGATTCCATAGCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153781.1-281s21c1
Sequence:CCGGGCACGCAGCAGCATTACTATGCTCGAGCATAGTAATGCTGCTGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153781.1-3385s21c1
Sequence:CCGGTCTGCTAGGCTGACGACTAAGCTCGAGCTTAGTCGTCAGCCTAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153781.1-164s1c1
Sequence:CCGGGCTTCAACAGACACCTGCATTCTCGAGAATGCAGGTGTCTGTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153781.1-2019s1c1
Sequence:CCGGCCGTGTGTCTTTAGCTGAGAACTCGAGTTCTCAGCTAAAGACACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153781
VALIDATED
PYGB MISSION shRNA Lentiviral Transduction Particles
phosphorylase, glycogen; brain
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153781.1-2377s21c1
Sequence:CCGGCACGACAGATTCAAGGTATTTCTCGAGAAATACCTTGAATCTGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153781.1-1826s21c1
Sequence:CCGGTCACCCTGTACAACCGAATAACTCGAGTTATTCGGTTGTACAGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153781.1-538s21c1
Sequence:CCGGTACGGCTATGGAATCCGATATCTCGAGATATCGGATTCCATAGCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153781.1-281s21c1
Sequence:CCGGGCACGCAGCAGCATTACTATGCTCGAGCATAGTAATGCTGCTGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246768    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153781.1-3385s21c1
Sequence:CCGGTCTGCTAGGCTGACGACTAAGCTCGAGCTTAGTCGTCAGCCTAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153781.1-164s1c1
Sequence:CCGGGCTTCAACAGACACCTGCATTCTCGAGAATGCAGGTGTCTGTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153781.1-2019s1c1
Sequence:CCGGCCGTGTGTCTTTAGCTGAGAACTCGAGTTCTCAGCTAAAGACACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks