EMAIL THIS PAGE TO A FRIEND

PYROXD1

pyridine nucleotide-disulphide oxidoreductase domain 1

UniProtKB ID: Q8WU10, A6NKI6, Q9H6P1
Gene ID:
Mouse(232491) pyridine nucleotide-disulphide oxidoreductase domain 1
Rat(297708) pyridine nucleotide-disulphide oxidoreductase domain 1
chicken(418191) pyridine nucleotide-disulphide oxidoreductase domain 1
domestic cat(101088088) pyridine nucleotide-disulphide oxidoreductase domain 1
dog(477678) pyridine nucleotide-disulphide oxidoreductase domain 1
cow(505859) pyridine nucleotide-disulphide oxidoreductase domain 1
sheep(101119461) pyridine nucleotide-disulphide oxidoreductase domain 1
domestic guinea pig(100719418) pyridine nucleotide-disulphide oxidoreductase domain 1
naked mole-rat(101701816) pyridine nucleotide-disulphide oxidoreductase domain 1
Domestic Rabbit(100354106) pyridine nucleotide-disulphide oxidoreductase domain 1
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024854 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024854 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024854 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183165 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183165 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183165 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024854 Rosetta Predictions human pricing
NM_001004234 Rosetta Predictions rat pricing
NM_183165 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024854 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028128 predicted 1348
2 SASI_Hs01_00028129 predicted 916
3 SASI_Hs01_00028132 predicted 822
4 SASI_Hs02_00357429 predicted 1569
5 SASI_Hs01_00028134 predicted 710
6 SASI_Hs02_00357430 predicted 1512
7 SASI_Hs02_00357431 predicted 766
8 SASI_Hs01_00028135 predicted 851
9 SASI_Hs02_00357432 predicted 716
10 SASI_Hs02_00357433 predicted 1480
11 SASI_Hs01_00028126 predicted 293
12 SASI_Hs01_00028127 predicted 290
13 SASI_Hs01_00028130 predicted 504
14 SASI_Hs01_00028131 predicted 519
15 SASI_Hs01_00028133 predicted 767
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004234 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083077 predicted 798
2 SASI_Rn01_00083078 predicted 1501
3 SASI_Rn01_00083079 predicted 657
4 SASI_Rn01_00083080 predicted 568
5 SASI_Rn01_00083081 predicted 1496
6 SASI_Rn01_00083082 predicted 890
7 SASI_Rn01_00083083 predicted 1525
8 SASI_Rn01_00083084 predicted 298
9 SASI_Rn01_00083085 predicted 696
10 SASI_Rn02_00198238 predicted 256
11 SASI_Rn01_00083076 predicted 810
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183165 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350245 predicted 331
2 SASI_Mm01_00046295 predicted 507
3 SASI_Mm02_00350246 predicted 1425
4 SASI_Mm01_00046296 predicted 689
5 SASI_Mm02_00350247 predicted 1415
6 SASI_Mm01_00046300 predicted 542
7 SASI_Mm01_00046301 predicted 406
8 SASI_Mm01_00046302 predicted 824
9 SASI_Mm02_00350248 predicted 1391
10 SASI_Mm02_00350249 predicted 1527
11 SASI_Mm01_00046294 predicted 1265
12 SASI_Mm01_00046297 predicted 206
13 SASI_Mm01_00046298 predicted 825
14 SASI_Mm01_00046299 predicted 715
15 SASI_Mm01_00046303 predicted 494
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024854
VALIDATED
PYROXD1 MISSION shRNA Bacterial Glycerol Stock
pyridine nucleotide-disulphide oxidoreductase domain 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024854.3-1509s21c1
Sequence:CCGGTAATTGGTGAAACCGATTTAGCTCGAGCTAAATCGGTTTCACCAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024854.3-635s21c1
Sequence:CCGGGAAGTGATTTGGGCCATTAAACTCGAGTTTAATGGCCCAAATCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024854.3-1416s21c1
Sequence:CCGGTAGGTTCAGATCATGAATTAACTCGAGTTAATTCATGATCTGAACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024854.1-261s1c1
Sequence:CCGGCCCAACATTAAGGTTATAGAACTCGAGTTCTATAACCTTAATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_024854.1-117s1c1
Sequence:CCGGGCTACTCACTTTCCATCGGAACTCGAGTTCCGATGGAAAGTGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024854.1-958s1c1
Sequence:CCGGGCGATTTCATTGTCAGTGCTACTCGAGTAGCACTGACAATGAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_024854.1-661s1c1
Sequence:CCGGCCAGATATACAACTGAAGGAACTCGAGTTCCTTCAGTTGTATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_024854.1-494s1c1
Sequence:CCGGCGGTGGTATTGCACTTGAGTTCTCGAGAACTCAAGTGCAATACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024854
VALIDATED
PYROXD1 MISSION shRNA shRNA Plasmid DNA
pyridine nucleotide-disulphide oxidoreductase domain 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024854.3-1509s21c1
Sequence:CCGGTAATTGGTGAAACCGATTTAGCTCGAGCTAAATCGGTTTCACCAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024854.3-635s21c1
Sequence:CCGGGAAGTGATTTGGGCCATTAAACTCGAGTTTAATGGCCCAAATCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024854.3-1416s21c1
Sequence:CCGGTAGGTTCAGATCATGAATTAACTCGAGTTAATTCATGATCTGAACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024854.1-261s1c1
Sequence:CCGGCCCAACATTAAGGTTATAGAACTCGAGTTCTATAACCTTAATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_024854.1-117s1c1
Sequence:CCGGGCTACTCACTTTCCATCGGAACTCGAGTTCCGATGGAAAGTGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024854.1-958s1c1
Sequence:CCGGGCGATTTCATTGTCAGTGCTACTCGAGTAGCACTGACAATGAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_024854.1-661s1c1
Sequence:CCGGCCAGATATACAACTGAAGGAACTCGAGTTCCTTCAGTTGTATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_024854.1-494s1c1
Sequence:CCGGCGGTGGTATTGCACTTGAGTTCTCGAGAACTCAAGTGCAATACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024854
VALIDATED
PYROXD1 MISSION shRNA Lentiviral Transduction Particles
pyridine nucleotide-disulphide oxidoreductase domain 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024854.3-1509s21c1
Sequence:CCGGTAATTGGTGAAACCGATTTAGCTCGAGCTAAATCGGTTTCACCAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024854.3-635s21c1
Sequence:CCGGGAAGTGATTTGGGCCATTAAACTCGAGTTTAATGGCCCAAATCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024854.3-1416s21c1
Sequence:CCGGTAGGTTCAGATCATGAATTAACTCGAGTTAATTCATGATCTGAACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024854.1-261s1c1
Sequence:CCGGCCCAACATTAAGGTTATAGAACTCGAGTTCTATAACCTTAATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_024854.1-117s1c1
Sequence:CCGGGCTACTCACTTTCCATCGGAACTCGAGTTCCGATGGAAAGTGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024854.1-958s1c1
Sequence:CCGGGCGATTTCATTGTCAGTGCTACTCGAGTAGCACTGACAATGAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_024854.1-661s1c1
Sequence:CCGGCCAGATATACAACTGAAGGAACTCGAGTTCCTTCAGTTGTATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_024854.1-494s1c1
Sequence:CCGGCGGTGGTATTGCACTTGAGTTCTCGAGAACTCAAGTGCAATACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183165
VALIDATED
PYROXD1 MISSION shRNA Bacterial Glycerol Stock
pyridine nucleotide-disulphide oxidoreductase domain 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183165.1-572s1c1
Sequence:CCGGGCCATAAAGGATAACGCCATTCTCGAGAATGGCGTTATCCTTTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183165.1-1428s1c1
Sequence:CCGGGAGCCGTCTTAATTGGTGAAACTCGAGTTTCACCAATTAAGACGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183165.1-1237s1c1
Sequence:CCGGCATGGGACATCCTATTGACATCTCGAGATGTCAATAGGATGTCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183165.1-720s1c1
Sequence:CCGGGAACCAAATCTAAAGCTGATTCTCGAGAATCAGCTTTAGATTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183165.1-1378s1c1
Sequence:CCGGCAGAGGACAAGAGTATGTCAACTCGAGTTGACATACTCTTGTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183165
VALIDATED
PYROXD1 MISSION shRNA shRNA Plasmid DNA
pyridine nucleotide-disulphide oxidoreductase domain 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183165.1-572s1c1
Sequence:CCGGGCCATAAAGGATAACGCCATTCTCGAGAATGGCGTTATCCTTTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183165.1-1428s1c1
Sequence:CCGGGAGCCGTCTTAATTGGTGAAACTCGAGTTTCACCAATTAAGACGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183165.1-1237s1c1
Sequence:CCGGCATGGGACATCCTATTGACATCTCGAGATGTCAATAGGATGTCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183165.1-720s1c1
Sequence:CCGGGAACCAAATCTAAAGCTGATTCTCGAGAATCAGCTTTAGATTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183165.1-1378s1c1
Sequence:CCGGCAGAGGACAAGAGTATGTCAACTCGAGTTGACATACTCTTGTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183165
VALIDATED
PYROXD1 MISSION shRNA Lentiviral Transduction Particles
pyridine nucleotide-disulphide oxidoreductase domain 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183165.1-572s1c1
Sequence:CCGGGCCATAAAGGATAACGCCATTCTCGAGAATGGCGTTATCCTTTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183165.1-1428s1c1
Sequence:CCGGGAGCCGTCTTAATTGGTGAAACTCGAGTTTCACCAATTAAGACGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_183165.1-1237s1c1
Sequence:CCGGCATGGGACATCCTATTGACATCTCGAGATGTCAATAGGATGTCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183165.1-720s1c1
Sequence:CCGGGAACCAAATCTAAAGCTGATTCTCGAGAATCAGCTTTAGATTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183165.1-1378s1c1
Sequence:CCGGCAGAGGACAAGAGTATGTCAACTCGAGTTGACATACTCTTGTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks