EMAIL THIS PAGE TO A FRIEND

PZP

pregnancy-zone protein

Synonyms: CPAMD6
UniProtKB ID: P20742, A6ND27, Q15273, Q2NKL2, Q7M4N7
Gene ID:
Mouse(11287) pregnancy zone protein
Rat(252922) pregnancy-zone protein
Zebrafish(324982) pregnancy-zone protein
dog(100685101) pregnancy-zone protein
domestic cat(101080718) pregnancy-zone protein
Domestic Rabbit(100352842) pregnancy-zone protein
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0545 AQUA Peptide SLFTDLVAE[K] human pricing
AQ0546 AQUA Peptide VVVQTESGG[R] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007376 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007376 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007376 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002864 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002864 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002864 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002864 Rosetta Predictions human pricing
NM_145779 Rosetta Predictions rat pricing
NM_007376 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002864 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078850 predicted 4369
2 SASI_Hs01_00078851 predicted 1978
3 SASI_Hs02_00334635 predicted 489
4 SASI_Hs01_00078853 predicted 1427
5 SASI_Hs01_00078854 predicted 451
6 SASI_Hs01_00078857 predicted 4309
7 SASI_Hs02_00334636 predicted 2972
8 SASI_Hs02_00334637 predicted 2467
9 SASI_Hs02_00334638 predicted 3058
10 SASI_Hs02_00334639 predicted 3226
11 SASI_Hs01_00078852 predicted 4275
12 SASI_Hs01_00078855 predicted 2673
13 SASI_Hs01_00078856 predicted 3210
14 SASI_Hs01_00078858 predicted 4197
15 SASI_Hs01_00078859 predicted 586
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145779 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103681 predicted 265
2 SASI_Rn01_00103682 predicted 841
3 SASI_Rn02_00268786 predicted 2617
4 SASI_Rn01_00103685 predicted 1132
5 SASI_Rn01_00103686 predicted 761
6 SASI_Rn01_00103687 predicted 299
7 SASI_Rn01_00103688 predicted 2454
8 SASI_Rn01_00103689 predicted 2372
9 SASI_Rn02_00268787 predicted 1101
10 SASI_Rn02_00268788 predicted 1511
11 SASI_Rn01_00103680 predicted 1083
12 SASI_Rn01_00103683 predicted 3688
13 SASI_Rn01_00103684 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007376 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117894 predicted 4258
2 SASI_Mm01_00117895 predicted 524
3 SASI_Mm01_00117896 predicted 4181
4 SASI_Mm01_00117897 predicted 4281
5 SASI_Mm01_00117898 predicted 2729
6 SASI_Mm02_00311470 predicted 1476
7 SASI_Mm01_00117899 predicted 2863
8 SASI_Mm01_00117900 predicted 720
9 SASI_Mm01_00117902 predicted 3033
10 SASI_Mm01_00117903 predicted 4025
11 SASI_Mm01_00117901 predicted 1759
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007376
PZP MISSION shRNA Bacterial Glycerol Stock
pregnancy-zone protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007376.1-4028s1c1
Sequence:CCGGCCCGGAAATTACGTCACCAAACTCGAGTTTGGTGACGTAATTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007376.1-638s1c1
Sequence:CCGGGCTCTGGGTATCTACAAGGTTCTCGAGAACCTTGTAGATACCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007376.1-4069s1c1
Sequence:CCGGGTACCTTCAGACATCTCTAAACTCGAGTTTAGAGATGTCTGAAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007376.1-2825s1c1
Sequence:CCGGCAAACGTACAACACACTGTTACTCGAGTAACAGTGTGTTGTACGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007376.1-1475s1c1
Sequence:CCGGCGGATACACTACCTCTTGAATCTCGAGATTCAAGAGGTAGTGTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007376
PZP MISSION shRNA shRNA Plasmid DNA
pregnancy-zone protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007376.1-4028s1c1
Sequence:CCGGCCCGGAAATTACGTCACCAAACTCGAGTTTGGTGACGTAATTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007376.1-638s1c1
Sequence:CCGGGCTCTGGGTATCTACAAGGTTCTCGAGAACCTTGTAGATACCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007376.1-4069s1c1
Sequence:CCGGGTACCTTCAGACATCTCTAAACTCGAGTTTAGAGATGTCTGAAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007376.1-2825s1c1
Sequence:CCGGCAAACGTACAACACACTGTTACTCGAGTAACAGTGTGTTGTACGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007376.1-1475s1c1
Sequence:CCGGCGGATACACTACCTCTTGAATCTCGAGATTCAAGAGGTAGTGTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007376
PZP MISSION shRNA Lentiviral Transduction Particles
pregnancy-zone protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007376.1-4028s1c1
Sequence:CCGGCCCGGAAATTACGTCACCAAACTCGAGTTTGGTGACGTAATTTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007376.1-638s1c1
Sequence:CCGGGCTCTGGGTATCTACAAGGTTCTCGAGAACCTTGTAGATACCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007376.1-4069s1c1
Sequence:CCGGGTACCTTCAGACATCTCTAAACTCGAGTTTAGAGATGTCTGAAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007376.1-2825s1c1
Sequence:CCGGCAAACGTACAACACACTGTTACTCGAGTAACAGTGTGTTGTACGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007376.1-1475s1c1
Sequence:CCGGCGGATACACTACCTCTTGAATCTCGAGATTCAAGAGGTAGTGTATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002864
PZP MISSION shRNA Bacterial Glycerol Stock
pregnancy-zone protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002864.1-3473s1c1
Sequence:CCGGCCATGTCTACACCAAGGCATTCTCGAGAATGCCTTGGTGTAGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002864.1-1978s1c1
Sequence:CCGGCCATCTATGTTCCCTTATCAACTCGAGTTGATAAGGGAACATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002864.1-492s1c1
Sequence:CCGGCGCCCTCGAAATGAACTGATTCTCGAGAATCAGTTCATTTCGAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002864.1-705s1c1
Sequence:CCGGCCCAAGTTTGAGGTCAAAGTTCTCGAGAACTTTGACCTCAAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002864.1-1447s1c1
Sequence:CCGGCGGCACACTATACACTGAATACTCGAGTATTCAGTGTATAGTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002864
PZP MISSION shRNA shRNA Plasmid DNA
pregnancy-zone protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002864.1-3473s1c1
Sequence:CCGGCCATGTCTACACCAAGGCATTCTCGAGAATGCCTTGGTGTAGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002864.1-1978s1c1
Sequence:CCGGCCATCTATGTTCCCTTATCAACTCGAGTTGATAAGGGAACATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002864.1-492s1c1
Sequence:CCGGCGCCCTCGAAATGAACTGATTCTCGAGAATCAGTTCATTTCGAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002864.1-705s1c1
Sequence:CCGGCCCAAGTTTGAGGTCAAAGTTCTCGAGAACTTTGACCTCAAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002864.1-1447s1c1
Sequence:CCGGCGGCACACTATACACTGAATACTCGAGTATTCAGTGTATAGTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002864
PZP MISSION shRNA Lentiviral Transduction Particles
pregnancy-zone protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002864.1-3473s1c1
Sequence:CCGGCCATGTCTACACCAAGGCATTCTCGAGAATGCCTTGGTGTAGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002864.1-1978s1c1
Sequence:CCGGCCATCTATGTTCCCTTATCAACTCGAGTTGATAAGGGAACATAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002864.1-492s1c1
Sequence:CCGGCGCCCTCGAAATGAACTGATTCTCGAGAATCAGTTCATTTCGAGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002864.1-705s1c1
Sequence:CCGGCCCAAGTTTGAGGTCAAAGTTCTCGAGAACTTTGACCTCAAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002864.1-1447s1c1
Sequence:CCGGCGGCACACTATACACTGAATACTCGAGTATTCAGTGTATAGTGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks