EMAIL THIS PAGE TO A FRIEND

QRFP

pyroglutamylated RFamide peptide

Synonyms: 26RFa P518
UniProtKB ID: P83859, A3KFJ6, Q495K6
Gene ID:
Human(347148) Summary: The P518 precursor protein can be processed into several RF (arg-phe)-amide peptides, including P518. RF-amide peptides share a common C-terminal motif and are involved in cell signaling through G protein-coupled receptors (Jiang et al., 2003 [PubMed 12714592]
Mouse(227717) pyroglutamylated RFamide peptide
Rat(379044) pyroglutamylated RFamide peptide
chicken(771867) pyroglutamylated RFamide peptide
dog(608592) pyroglutamylated RFamide peptide
domestic cat(101098017) pyroglutamylated RFamide peptide
cow(379045) pyroglutamylated RFamide peptide
sheep(100145885) pyroglutamylated RFamide peptide
naked mole-rat(101697478) pyroglutamylated RFamide peptide
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183424 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183424 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183424 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198180 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198180 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198180 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055951 MISSION® esiRNA esiRNA human QRFP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198180 Rosetta Predictions human pricing
NM_198200 Rosetta Predictions rat pricing
NM_183424 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097858 predicted 189
2 SASI_Hs01_00097859 predicted 183
3 SASI_Hs02_00371707 predicted 349
4 SASI_Hs01_00097860 predicted 165
5 SASI_Hs01_00097862 predicted 38
6 SASI_Hs01_00097863 predicted 335
7 SASI_Hs02_00371708 predicted 43
8 SASI_Hs01_00097864 predicted 37
9 SASI_Hs01_00097865 predicted 255
10 SASI_Hs01_00097866 predicted 316
11 SASI_Hs01_00097861 predicted 60
12 SASI_Hs01_00097867 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198200 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121365 predicted 69
2 SASI_Rn01_00121366 predicted 161
3 SASI_Rn01_00121367 predicted 195
4 SASI_Rn01_00121368 predicted 204
5 SASI_Rn01_00121369 predicted 194
6 SASI_Rn01_00121370 predicted 10
7 SASI_Rn01_00121371 predicted 334
8 SASI_Rn01_00121372 predicted 260
9 SASI_Rn01_00121373 predicted 335
10 SASI_Rn01_00121374 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183424 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050729 predicted 935
2 SASI_Mm01_00050730 predicted 956
3 SASI_Mm01_00050731 predicted 336
4 SASI_Mm01_00050732 predicted 978
5 SASI_Mm01_00050733 predicted 543
6 SASI_Mm01_00050734 predicted 564
7 SASI_Mm01_00050735 predicted 588
8 SASI_Mm01_00050736 predicted 573
9 SASI_Mm01_00050737 predicted 572
10 SASI_Mm01_00050738 predicted 743
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183424
QRFP MISSION shRNA Bacterial Glycerol Stock
pyroglutamylated RFamide peptide
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183424.3-944s21c1
Sequence:CCGGGGTAGGTGGACTGAGAGATTACTCGAGTAATCTCTCAGTCCACCTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183424.3-786s21c1
Sequence:CCGGGTCCTTATCCTAGCCCATGACCTCGAGGTCATGGGCTAGGATAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183424.3-204s21c1
Sequence:CCGGACATCGGAGCCAGGATGAACTCTCGAGAGTTCATCCTGGCTCCGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183424.1-1728s1c1
Sequence:CCGGCCAGCAGAACATCCCTTTCAACTCGAGTTGAAAGGGATGTTCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183424.1-2510s1c1
Sequence:CCGGCCTGGCTCATTCATACACATACTCGAGTATGTGTATGAATGAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183424.1-617s1c1
Sequence:CCGGCCAACTTTGCTAAAGTGAGAACTCGAGTTCTCACTTTAGCAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183424.1-1339s1c1
Sequence:CCGGGTTGAGTTTCAAATACCCAAACTCGAGTTTGGGTATTTGAAACTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183424.1-920s1c1
Sequence:CCGGCCTCTGGCTCTGTTGTTCATTCTCGAGAATGAACAACAGAGCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183424
QRFP MISSION shRNA shRNA Plasmid DNA
pyroglutamylated RFamide peptide
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183424.3-944s21c1
Sequence:CCGGGGTAGGTGGACTGAGAGATTACTCGAGTAATCTCTCAGTCCACCTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183424.3-786s21c1
Sequence:CCGGGTCCTTATCCTAGCCCATGACCTCGAGGTCATGGGCTAGGATAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183424.3-204s21c1
Sequence:CCGGACATCGGAGCCAGGATGAACTCTCGAGAGTTCATCCTGGCTCCGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183424.1-1728s1c1
Sequence:CCGGCCAGCAGAACATCCCTTTCAACTCGAGTTGAAAGGGATGTTCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183424.1-2510s1c1
Sequence:CCGGCCTGGCTCATTCATACACATACTCGAGTATGTGTATGAATGAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183424.1-617s1c1
Sequence:CCGGCCAACTTTGCTAAAGTGAGAACTCGAGTTCTCACTTTAGCAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183424.1-1339s1c1
Sequence:CCGGGTTGAGTTTCAAATACCCAAACTCGAGTTTGGGTATTTGAAACTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183424.1-920s1c1
Sequence:CCGGCCTCTGGCTCTGTTGTTCATTCTCGAGAATGAACAACAGAGCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183424
QRFP MISSION shRNA Lentiviral Transduction Particles
pyroglutamylated RFamide peptide
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442911    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183424.3-944s21c1
Sequence:CCGGGGTAGGTGGACTGAGAGATTACTCGAGTAATCTCTCAGTCCACCTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183424.3-786s21c1
Sequence:CCGGGTCCTTATCCTAGCCCATGACCTCGAGGTCATGGGCTAGGATAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183424.3-204s21c1
Sequence:CCGGACATCGGAGCCAGGATGAACTCTCGAGAGTTCATCCTGGCTCCGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183424.1-1728s1c1
Sequence:CCGGCCAGCAGAACATCCCTTTCAACTCGAGTTGAAAGGGATGTTCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183424.1-2510s1c1
Sequence:CCGGCCTGGCTCATTCATACACATACTCGAGTATGTGTATGAATGAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183424.1-617s1c1
Sequence:CCGGCCAACTTTGCTAAAGTGAGAACTCGAGTTCTCACTTTAGCAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183424.1-1339s1c1
Sequence:CCGGGTTGAGTTTCAAATACCCAAACTCGAGTTTGGGTATTTGAAACTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183424.1-920s1c1
Sequence:CCGGCCTCTGGCTCTGTTGTTCATTCTCGAGAATGAACAACAGAGCCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198180
QRFP MISSION shRNA Bacterial Glycerol Stock
pyroglutamylated RFamide peptide
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198180.1-166s21c1
Sequence:CCGGTCTCGGTGGCTGAGAGCTTCACTCGAGTGAAGCTCTCAGCCACCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198180.1-237s21c1
Sequence:CCGGAGAGCATGCTGGCTGCAGATTCTCGAGAATCTGCAGCCAGCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198180.1-226s21c1
Sequence:CCGGACATCGGGCAGAGAGCATGCTCTCGAGAGCATGCTCTCTGCCCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198180.1-53s21c1
Sequence:CCGGGCTTCCCTCTACTGGACAGAACTCGAGTTCTGTCCAGTAGAGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198180.1-191s21c1
Sequence:CCGGCACAGGCCCTGCTTGTCATAGCTCGAGCTATGACAAGCAGGGCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198180.1-190s1c1
Sequence:CCGGCCACAGGCCCTGCTTGTCATACTCGAGTATGACAAGCAGGGCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198180
QRFP MISSION shRNA shRNA Plasmid DNA
pyroglutamylated RFamide peptide
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198180.1-166s21c1
Sequence:CCGGTCTCGGTGGCTGAGAGCTTCACTCGAGTGAAGCTCTCAGCCACCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198180.1-237s21c1
Sequence:CCGGAGAGCATGCTGGCTGCAGATTCTCGAGAATCTGCAGCCAGCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198180.1-226s21c1
Sequence:CCGGACATCGGGCAGAGAGCATGCTCTCGAGAGCATGCTCTCTGCCCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198180.1-53s21c1
Sequence:CCGGGCTTCCCTCTACTGGACAGAACTCGAGTTCTGTCCAGTAGAGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198180.1-191s21c1
Sequence:CCGGCACAGGCCCTGCTTGTCATAGCTCGAGCTATGACAAGCAGGGCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198180.1-190s1c1
Sequence:CCGGCCACAGGCCCTGCTTGTCATACTCGAGTATGACAAGCAGGGCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198180
QRFP MISSION shRNA Lentiviral Transduction Particles
pyroglutamylated RFamide peptide
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198180.1-166s21c1
Sequence:CCGGTCTCGGTGGCTGAGAGCTTCACTCGAGTGAAGCTCTCAGCCACCGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198180.1-237s21c1
Sequence:CCGGAGAGCATGCTGGCTGCAGATTCTCGAGAATCTGCAGCCAGCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198180.1-226s21c1
Sequence:CCGGACATCGGGCAGAGAGCATGCTCTCGAGAGCATGCTCTCTGCCCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198180.1-53s21c1
Sequence:CCGGGCTTCCCTCTACTGGACAGAACTCGAGTTCTGTCCAGTAGAGGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198180.1-191s21c1
Sequence:CCGGCACAGGCCCTGCTTGTCATAGCTCGAGCTATGACAAGCAGGGCCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198180.1-190s1c1
Sequence:CCGGCCACAGGCCCTGCTTGTCATACTCGAGTATGACAAGCAGGGCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks