EMAIL THIS PAGE TO A FRIEND

RAB12

RAB12, member RAS oncogene family

UniProtKB ID: Q6IQ22, A6NEF5, Q4KMQ3
Gene ID:
Mouse(19328) RAB12, member RAS oncogene family
Rat(25530) RAB12, member RAS oncogene family
Zebrafish(553657) RAB12, member RAS oncogene family
chicken(421048) RAB12, member RAS oncogene family
domestic cat(101083039) RAB12, member RAS oncogene family
Horse(100049860) RAB12, member RAS oncogene family
dog(403865) RAB12, member RAS oncogene family
domestic guinea pig(100714002) RAB12, member RAS oncogene family
cow(615804) RAB12, member RAS oncogene family
sheep(101103204) RAB12, member RAS oncogene family
115 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0241 AQUA Peptide LQIWDTAGQE[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing
AQ0271 AQUA Peptide LQIWDTAGQE[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024448 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024448 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024448 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001025300 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001025300 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001025300 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025300 Rosetta Predictions human pricing
NM_013017 Rosetta Predictions rat pricing
NM_024448 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025300 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307437 predicted 1063
2 SASI_Hs02_00307438 predicted 1095
3 SASI_Hs02_00307439 predicted 596
4 SASI_Hs02_00307440 predicted 594
5 SASI_Hs02_00307441 predicted 1064
6 SASI_Hs02_00307442 predicted 691
7 SASI_Hs02_00307443 predicted 959
8 SASI_Hs02_00307444 predicted 1108
9 SASI_Hs02_00307445 predicted 948
10 SASI_Hs02_00307446 predicted 1110
11 SASI_Hs01_00140537 predicted 973
12 SASI_Hs01_00140538 predicted 2751
13 SASI_Hs01_00140539 predicted 1930
14 SASI_Hs01_00140540 predicted 4973
15 SASI_Hs01_00140541 predicted 4636
16 SASI_Hs01_00140542 predicted 2914
17 SASI_Hs01_00140543 predicted 1796
18 SASI_Hs01_00140544 predicted 2378
19 SASI_Hs01_00140545 predicted 3733
20 SASI_Hs01_00140546 predicted 4071
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013017 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260681 predicted 650
2 SASI_Rn02_00260682 predicted 710
3 SASI_Rn02_00260683 predicted 374
4 SASI_Rn02_00260684 predicted 888
5 SASI_Rn02_00260685 predicted 648
6 SASI_Rn02_00260686 predicted 468
7 SASI_Rn02_00260687 predicted 863
8 SASI_Rn02_00260688 predicted 580
9 SASI_Rn02_00260689 predicted 473
10 SASI_Rn02_00260690 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024448 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067539 predicted 743
2 SASI_Mm01_00067541 predicted 508
3 SASI_Mm01_00067542 predicted 681
4 SASI_Mm01_00067543 predicted 683
5 SASI_Mm02_00327791 predicted 874
6 SASI_Mm01_00067544 predicted 929
7 SASI_Mm01_00067545 predicted 899
8 SASI_Mm01_00067546 predicted 407
9 SASI_Mm01_00067547 predicted 743
10 SASI_Mm01_00067548 predicted 619
11 SASI_Mm01_00067540 predicted 915
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024448
VALIDATED
RAB12 MISSION shRNA Bacterial Glycerol Stock
RAB12, member RAS oncogene family
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024448.2-413s21c1
Sequence:CCGGAGCATTACCTCAGCCTATTACCTCGAGGTAATAGGCTGAGGTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024448.2-317s21c1
Sequence:CCGGACCGTGGGTGTTGACTTTAAACTCGAGTTTAAAGTCAACACCCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024448.2-976s21c1
Sequence:CCGGTGGGTAAGGTCGGGTTATATACTCGAGTATATAACCCGACCTTACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024448.2-391s21c1
Sequence:CCGGAGCAGGGCAGGAGCGATTTAACTCGAGTTAAATCGCTCCTGCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024448.2-669s21c1
Sequence:CCGGTCAATGTGGACGAGATCTTTCCTCGAGGAAAGATCTCGTCCACATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024448.1-198s1c1
Sequence:CCGGCCAGGTGTATGCAGTTCAAATCTCGAGATTTGAACTGCATACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024448.1-105s1c1
Sequence:CCGGCCAGGAAGAAGTAATGCAGATCTCGAGATCTGCATTACTTCTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191725    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024448.1-826s1c1
Sequence:CCGGGCGTAGTACTTCTAATACGAACTCGAGTTCGTATTAGAAGTACTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024448
VALIDATED
RAB12 MISSION shRNA shRNA Plasmid DNA
RAB12, member RAS oncogene family
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024448.2-413s21c1
Sequence:CCGGAGCATTACCTCAGCCTATTACCTCGAGGTAATAGGCTGAGGTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024448.2-317s21c1
Sequence:CCGGACCGTGGGTGTTGACTTTAAACTCGAGTTTAAAGTCAACACCCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024448.2-976s21c1
Sequence:CCGGTGGGTAAGGTCGGGTTATATACTCGAGTATATAACCCGACCTTACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024448.2-391s21c1
Sequence:CCGGAGCAGGGCAGGAGCGATTTAACTCGAGTTAAATCGCTCCTGCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024448.2-669s21c1
Sequence:CCGGTCAATGTGGACGAGATCTTTCCTCGAGGAAAGATCTCGTCCACATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024448.1-198s1c1
Sequence:CCGGCCAGGTGTATGCAGTTCAAATCTCGAGATTTGAACTGCATACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024448.1-105s1c1
Sequence:CCGGCCAGGAAGAAGTAATGCAGATCTCGAGATCTGCATTACTTCTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191725    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024448.1-826s1c1
Sequence:CCGGGCGTAGTACTTCTAATACGAACTCGAGTTCGTATTAGAAGTACTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024448
VALIDATED
RAB12 MISSION shRNA Lentiviral Transduction Particles
RAB12, member RAS oncogene family
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024448.2-413s21c1
Sequence:CCGGAGCATTACCTCAGCCTATTACCTCGAGGTAATAGGCTGAGGTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024448.2-317s21c1
Sequence:CCGGACCGTGGGTGTTGACTTTAAACTCGAGTTTAAAGTCAACACCCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024448.2-976s21c1
Sequence:CCGGTGGGTAAGGTCGGGTTATATACTCGAGTATATAACCCGACCTTACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024448.2-391s21c1
Sequence:CCGGAGCAGGGCAGGAGCGATTTAACTCGAGTTAAATCGCTCCTGCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024448.2-669s21c1
Sequence:CCGGTCAATGTGGACGAGATCTTTCCTCGAGGAAAGATCTCGTCCACATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024448.1-198s1c1
Sequence:CCGGCCAGGTGTATGCAGTTCAAATCTCGAGATTTGAACTGCATACACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024448.1-105s1c1
Sequence:CCGGCCAGGAAGAAGTAATGCAGATCTCGAGATCTGCATTACTTCTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191725    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024448.1-826s1c1
Sequence:CCGGGCGTAGTACTTCTAATACGAACTCGAGTTCGTATTAGAAGTACTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025300
VALIDATED
RAB12 MISSION shRNA Bacterial Glycerol Stock
RAB12, member RAS oncogene family
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025300.2-405s21c1
Sequence:CCGGTCAAGTTGCAGGTCATCATTACTCGAGTAATGATGACCTGCAACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001025300.2-1646s21c1
Sequence:CCGGTTCCTAAGGGATGTACCTTTACTCGAGTAAAGGTACATCCCTTAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245721    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001025300.2-1869s21c1
Sequence:CCGGGTGAAGCTTATTCTGATTAAGCTCGAGCTTAATCAGAATAAGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001025300.2-1797s21c1
Sequence:CCGGATCAAAGAACATACGTGTATTCTCGAGAATACACGTATGTTCTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001025300.2-1830s21c1
Sequence:CCGGCTGTACCTTTGTAATGATAAACTCGAGTTTATCATTACAAAGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025300.1-408s1c1
Sequence:CCGGCGACTTCAAGTTGCAGGTCATCTCGAGATGACCTGCAACTTGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025300.1-411s1c1
Sequence:CCGGCTTCAAGTTGCAGGTCATCATCTCGAGATGATGACCTGCAACTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025300
VALIDATED
RAB12 MISSION shRNA shRNA Plasmid DNA
RAB12, member RAS oncogene family
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025300.2-405s21c1
Sequence:CCGGTCAAGTTGCAGGTCATCATTACTCGAGTAATGATGACCTGCAACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001025300.2-1646s21c1
Sequence:CCGGTTCCTAAGGGATGTACCTTTACTCGAGTAAAGGTACATCCCTTAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245721    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001025300.2-1869s21c1
Sequence:CCGGGTGAAGCTTATTCTGATTAAGCTCGAGCTTAATCAGAATAAGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001025300.2-1797s21c1
Sequence:CCGGATCAAAGAACATACGTGTATTCTCGAGAATACACGTATGTTCTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001025300.2-1830s21c1
Sequence:CCGGCTGTACCTTTGTAATGATAAACTCGAGTTTATCATTACAAAGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025300.1-408s1c1
Sequence:CCGGCGACTTCAAGTTGCAGGTCATCTCGAGATGACCTGCAACTTGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025300.1-411s1c1
Sequence:CCGGCTTCAAGTTGCAGGTCATCATCTCGAGATGATGACCTGCAACTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025300
VALIDATED
RAB12 MISSION shRNA Lentiviral Transduction Particles
RAB12, member RAS oncogene family
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025300.2-405s21c1
Sequence:CCGGTCAAGTTGCAGGTCATCATTACTCGAGTAATGATGACCTGCAACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001025300.2-1646s21c1
Sequence:CCGGTTCCTAAGGGATGTACCTTTACTCGAGTAAAGGTACATCCCTTAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245721    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001025300.2-1869s21c1
Sequence:CCGGGTGAAGCTTATTCTGATTAAGCTCGAGCTTAATCAGAATAAGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245720    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001025300.2-1797s21c1
Sequence:CCGGATCAAAGAACATACGTGTATTCTCGAGAATACACGTATGTTCTTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001025300.2-1830s21c1
Sequence:CCGGCTGTACCTTTGTAATGATAAACTCGAGTTTATCATTACAAAGGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180002    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025300.1-408s1c1
Sequence:CCGGCGACTTCAAGTTGCAGGTCATCTCGAGATGACCTGCAACTTGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025300.1-411s1c1
Sequence:CCGGCTTCAAGTTGCAGGTCATCATCTCGAGATGATGACCTGCAACTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks