EMAIL THIS PAGE TO A FRIEND

RAB18

RAB18, member RAS oncogene family

Synonyms: RAB18LI1 WARBM3
Gene ID:
Human(22931) Summary: The protein encoded by this gene is a member of a family of Ras-related small GTPases that regulate membrane trafficking in organelles and transport vesicles. Knockdown studies is zebrafish suggest that this protein may have a role in eye and brain development. Mutations in this gene are associated with Warburg micro syndrome type 3. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(19330) RAB18, member RAS oncogene family
Rat(307039) RAB18, member RAS oncogene family
fruit fly(44360) CG3129 gene product from transcript CG3129-RA
domestic cat(101088004) RAB18, member RAS oncogene family
dog(491408) RAB18, member RAS oncogene family
chicken(420483) RAB18, member RAS oncogene family
Thale Cress(840987) Ras-related protein Rab-18
Thale Cress(836772) dehydrin Rab18
cow(511160) RAB18, member RAS oncogene family
cow(282026) RAB18, member RAS oncogene family
sheep(101118629) RAB18, member RAS oncogene family
domestic guinea pig(100721700) RAB18, member RAS oncogene family
naked mole-rat(101697571) RAB18, member RAS oncogene family
192 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011225 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011225 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011225 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021252 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021252 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021252 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181070 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181070 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181070 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021252 Rosetta Predictions human pricing
NM_001012468 Rosetta Predictions rat pricing
NM_011225 Rosetta Predictions mouse pricing
NM_181070 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021252 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134719 predicted 345
2 SASI_Hs01_00134720 predicted 598
3 SASI_Hs01_00134721 predicted 309
4 SASI_Hs01_00134722 predicted 532
5 SASI_Hs01_00134723 predicted 291
6 SASI_Hs01_00134724 predicted 657
7 SASI_Hs01_00134725 predicted 322
8 SASI_Hs01_00134726 predicted 751
9 SASI_Hs01_00134727 predicted 370
10 SASI_Hs01_00134728 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012468 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200573 predicted 338
2 SASI_Rn01_00093449 predicted 516
3 SASI_Rn01_00093451 predicted 316
4 SASI_Rn01_00093452 predicted 366
5 SASI_Rn02_00200574 predicted 438
6 SASI_Rn01_00093453 predicted 523
7 SASI_Rn01_00093454 predicted 288
8 SASI_Rn01_00093455 predicted 359
9 SASI_Rn01_00093456 predicted 467
10 SASI_Rn01_00093458 predicted 389
11 SASI_Rn01_00093450 predicted 260
12 SASI_Rn01_00093457 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011225 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188999 predicted 423
2 SASI_Mm01_00189000 predicted 298
3 SASI_Mm01_00189001 predicted 327
4 SASI_Mm01_00189002 predicted 393
5 SASI_Mm01_00189003 predicted 247
6 SASI_Mm01_00189004 predicted 316
7 SASI_Mm01_00189005 predicted 415
8 SASI_Mm02_00320185 predicted 278
9 SASI_Mm01_00189006 predicted 425
10 SASI_Mm01_00189007 predicted 278
11 SASI_Mm01_00189008 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181070 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037293 predicted 474
2 SASI_Mm01_00037294 predicted 361
3 SASI_Mm01_00037295 predicted 378
4 SASI_Mm01_00037296 predicted 455
5 SASI_Mm01_00037297 predicted 300
6 SASI_Mm01_00037298 predicted 368
7 SASI_Mm01_00037299 predicted 473
8 SASI_Mm02_00349626 predicted 338
9 SASI_Mm01_00037300 predicted 483
10 SASI_Mm01_00037301 predicted 334
11 SASI_Mm01_00037302 predicted 266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011225
VALIDATED
RAB18 MISSION shRNA Bacterial Glycerol Stock
RAB18, member RAS oncogene family
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011225.1-248s1c1
Sequence:CCGGCAGGGAGTTATATTAGTCTATCTCGAGATAGACTAATATAACTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011225.1-227s1c1
Sequence:CCGGCCCAGCTATTATAGAGGTGCACTCGAGTGCACCTCTATAATAGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011225.1-397s1c1
Sequence:CCGGCGATAGAAATGAAGGCTTGAACTCGAGTTCAAGCCTTCATTTCTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011225.1-161s1c1
Sequence:CCGGGATGGAAATAAGGCTAAACTTCTCGAGAAGTTTAGCCTTATTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011225.1-119s1c1
Sequence:CCGGGCAACAATAGGTGTTGACTTTCTCGAGAAAGTCAACACCTATTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011225.1-541s1c1
Sequence:CCGGGAACCAGAACAAAGGAGTCAACTCGAGTTGACTCCTTTGTTCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011225.1-173s1c1
Sequence:CCGGGCTAAACTTGCAATATGGGATCTCGAGATCCCATATTGCAAGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011225.1-203s1c1
Sequence:CCGGCAAGAGAGGTTCAGAACATTACTCGAGTAATGTTCTGAACCTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011225.1-497s1c1
Sequence:CCGGCTTGTTGAGAAGATCATTCAGCTCGAGCTGAATGATCTTCTCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011225.1-350s1c1
Sequence:CCGGGTAAACATGCTAGTTGGAAATCTCGAGATTTCCAACTAGCATGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011225
VALIDATED
RAB18 MISSION shRNA shRNA Plasmid DNA
RAB18, member RAS oncogene family
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011225.1-248s1c1
Sequence:CCGGCAGGGAGTTATATTAGTCTATCTCGAGATAGACTAATATAACTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011225.1-227s1c1
Sequence:CCGGCCCAGCTATTATAGAGGTGCACTCGAGTGCACCTCTATAATAGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011225.1-397s1c1
Sequence:CCGGCGATAGAAATGAAGGCTTGAACTCGAGTTCAAGCCTTCATTTCTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011225.1-161s1c1
Sequence:CCGGGATGGAAATAAGGCTAAACTTCTCGAGAAGTTTAGCCTTATTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011225.1-119s1c1
Sequence:CCGGGCAACAATAGGTGTTGACTTTCTCGAGAAAGTCAACACCTATTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011225.1-541s1c1
Sequence:CCGGGAACCAGAACAAAGGAGTCAACTCGAGTTGACTCCTTTGTTCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011225.1-173s1c1
Sequence:CCGGGCTAAACTTGCAATATGGGATCTCGAGATCCCATATTGCAAGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011225.1-203s1c1
Sequence:CCGGCAAGAGAGGTTCAGAACATTACTCGAGTAATGTTCTGAACCTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011225.1-497s1c1
Sequence:CCGGCTTGTTGAGAAGATCATTCAGCTCGAGCTGAATGATCTTCTCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011225.1-350s1c1
Sequence:CCGGGTAAACATGCTAGTTGGAAATCTCGAGATTTCCAACTAGCATGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011225
VALIDATED
RAB18 MISSION shRNA Lentiviral Transduction Particles
RAB18, member RAS oncogene family
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197499    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011225.1-248s1c1
Sequence:CCGGCAGGGAGTTATATTAGTCTATCTCGAGATAGACTAATATAACTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011225.1-227s1c1
Sequence:CCGGCCCAGCTATTATAGAGGTGCACTCGAGTGCACCTCTATAATAGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011225.1-397s1c1
Sequence:CCGGCGATAGAAATGAAGGCTTGAACTCGAGTTCAAGCCTTCATTTCTATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011225.1-161s1c1
Sequence:CCGGGATGGAAATAAGGCTAAACTTCTCGAGAAGTTTAGCCTTATTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011225.1-119s1c1
Sequence:CCGGGCAACAATAGGTGTTGACTTTCTCGAGAAAGTCAACACCTATTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011225.1-541s1c1
Sequence:CCGGGAACCAGAACAAAGGAGTCAACTCGAGTTGACTCCTTTGTTCTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011225.1-173s1c1
Sequence:CCGGGCTAAACTTGCAATATGGGATCTCGAGATCCCATATTGCAAGTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215331    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011225.1-203s1c1
Sequence:CCGGCAAGAGAGGTTCAGAACATTACTCGAGTAATGTTCTGAACCTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011225.1-497s1c1
Sequence:CCGGCTTGTTGAGAAGATCATTCAGCTCGAGCTGAATGATCTTCTCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011225.1-350s1c1
Sequence:CCGGGTAAACATGCTAGTTGGAAATCTCGAGATTTCCAACTAGCATGTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021252
VALIDATED
RAB18 MISSION shRNA Bacterial Glycerol Stock
RAB18, member RAS oncogene family
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021252.3-468s1c1
Sequence:CCGGGCACGAAAGCATTCCATGTTACTCGAGTAACATGGAATGCTTTCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021252.3-262s1c1
Sequence:CCGGGAACATTAACTCCCAGCTATTCTCGAGAATAGCTGGGAGTTAATGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021252.3-647s1c1
Sequence:CCGGTGGTGGTTATTGCTCTGTGTTCTCGAGAACACAGAGCAATAACCACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_021252.3-292s1c1
Sequence:CCGGCACAGGGTGTTATATTAGTTTCTCGAGAAACTAATATAACACCCTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021252.3-435s1c1
Sequence:CCGGCGTGAAGTCGATAGAAATGAACTCGAGTTCATTTCTATCGACTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021252
VALIDATED
RAB18 MISSION shRNA shRNA Plasmid DNA
RAB18, member RAS oncogene family
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021252.3-468s1c1
Sequence:CCGGGCACGAAAGCATTCCATGTTACTCGAGTAACATGGAATGCTTTCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021252.3-262s1c1
Sequence:CCGGGAACATTAACTCCCAGCTATTCTCGAGAATAGCTGGGAGTTAATGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021252.3-647s1c1
Sequence:CCGGTGGTGGTTATTGCTCTGTGTTCTCGAGAACACAGAGCAATAACCACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_021252.3-292s1c1
Sequence:CCGGCACAGGGTGTTATATTAGTTTCTCGAGAAACTAATATAACACCCTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021252.3-435s1c1
Sequence:CCGGCGTGAAGTCGATAGAAATGAACTCGAGTTCATTTCTATCGACTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021252
VALIDATED
RAB18 MISSION shRNA Lentiviral Transduction Particles
RAB18, member RAS oncogene family
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021252.3-468s1c1
Sequence:CCGGGCACGAAAGCATTCCATGTTACTCGAGTAACATGGAATGCTTTCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021252.3-262s1c1
Sequence:CCGGGAACATTAACTCCCAGCTATTCTCGAGAATAGCTGGGAGTTAATGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021252.3-647s1c1
Sequence:CCGGTGGTGGTTATTGCTCTGTGTTCTCGAGAACACAGAGCAATAACCACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_021252.3-292s1c1
Sequence:CCGGCACAGGGTGTTATATTAGTTTCTCGAGAAACTAATATAACACCCTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_021252.3-435s1c1
Sequence:CCGGCGTGAAGTCGATAGAAATGAACTCGAGTTCATTTCTATCGACTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181070
RAB18 MISSION shRNA Bacterial Glycerol Stock
RAB18, member RAS oncogene family
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181070.5-229s21c1
Sequence:CCGGGCTAAACTTGCAATATGGGATCTCGAGATCCCATATTGCAAGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181070.5-788s21c1
Sequence:CCGGTATCATGGCAGTGAGTATTTGCTCGAGCAAATACTCACTGCCATGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181070.5-351s21c1
Sequence:CCGGTAAACTGGATAACTGGTTAAACTCGAGTTTAACCAGTTATCCAGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181070.5-275s21c1
Sequence:CCGGCATTAACTCCCAGCTATTATACTCGAGTATAATAGCTGGGAGTTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181070.5-217s21c1
Sequence:CCGGGATGGAAATAAGGCTAAACTTCTCGAGAAGTTTAGCCTTATTTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181070
RAB18 MISSION shRNA shRNA Plasmid DNA
RAB18, member RAS oncogene family
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181070.5-229s21c1
Sequence:CCGGGCTAAACTTGCAATATGGGATCTCGAGATCCCATATTGCAAGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181070.5-788s21c1
Sequence:CCGGTATCATGGCAGTGAGTATTTGCTCGAGCAAATACTCACTGCCATGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181070.5-351s21c1
Sequence:CCGGTAAACTGGATAACTGGTTAAACTCGAGTTTAACCAGTTATCCAGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181070.5-275s21c1
Sequence:CCGGCATTAACTCCCAGCTATTATACTCGAGTATAATAGCTGGGAGTTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181070.5-217s21c1
Sequence:CCGGGATGGAAATAAGGCTAAACTTCTCGAGAAGTTTAGCCTTATTTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181070
RAB18 MISSION shRNA Lentiviral Transduction Particles
RAB18, member RAS oncogene family
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181070.5-229s21c1
Sequence:CCGGGCTAAACTTGCAATATGGGATCTCGAGATCCCATATTGCAAGTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181070.5-788s21c1
Sequence:CCGGTATCATGGCAGTGAGTATTTGCTCGAGCAAATACTCACTGCCATGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181070.5-351s21c1
Sequence:CCGGTAAACTGGATAACTGGTTAAACTCGAGTTTAACCAGTTATCCAGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181070.5-275s21c1
Sequence:CCGGCATTAACTCCCAGCTATTATACTCGAGTATAATAGCTGGGAGTTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181070.5-217s21c1
Sequence:CCGGGATGGAAATAAGGCTAAACTTCTCGAGAAGTTTAGCCTTATTTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks