EMAIL THIS PAGE TO A FRIEND

RAB20

RAB20, member RAS oncogene family

UniProtKB ID: Q9NX57, Q5T9X5, Q9NX49
Gene ID:
Mouse(19332) RAB20, member RAS oncogene family
Rat(689377) RAB20, member RAS oncogene family
Zebrafish(337199) RAB20, member RAS oncogene family
dog(485549) RAB20, member RAS oncogene family
domestic cat(101089416) RAB20, member RAS oncogene family
chicken(418753) RAB20, member RAS oncogene family
domestic guinea pig(100729848) RAB20, member RAS oncogene family
naked mole-rat(101718162) RAB20, member RAS oncogene family
cow(615760) RAB20, member RAS oncogene family
sheep(101116740) RAB20, member RAS oncogene family
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011227 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011227 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011227 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017817 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017817 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017817 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017817 Rosetta Predictions human pricing
NM_001109535 Rosetta Predictions rat pricing
NM_011227 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017817 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350683 predicted 847
2 SASI_Hs01_00124898 predicted 827
3 SASI_Hs01_00124899 predicted 722
4 SASI_Hs01_00124900 predicted 1280
5 SASI_Hs01_00124901 predicted 338
6 SASI_Hs02_00350684 predicted 948
7 SASI_Hs01_00124903 predicted 584
8 SASI_Hs02_00350685 predicted 847
9 SASI_Hs01_00124904 predicted 427
10 SASI_Hs02_00350686 predicted 1026
11 SASI_Hs01_00124896 predicted 810
12 SASI_Hs01_00124897 predicted 1277
13 SASI_Hs01_00124902 predicted 826
14 SASI_Hs01_00124905 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109535 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249359 predicted 486
2 SASI_Rn02_00249360 predicted 1139
3 SASI_Rn02_00249361 predicted 700
4 SASI_Rn02_00249362 predicted 960
5 SASI_Rn02_00249363 predicted 400
6 SASI_Rn02_00249364 predicted 636
7 SASI_Rn02_00249365 predicted 1074
8 SASI_Rn02_00249366 predicted 819
9 SASI_Rn02_00249367 predicted 1060
10 SASI_Rn02_00249368 predicted 1079
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011227 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103686 predicted 219
2 SASI_Mm01_00103687 predicted 450
3 SASI_Mm01_00103688 predicted 457
4 SASI_Mm02_00320187 predicted 276
5 SASI_Mm01_00103689 predicted 295
6 SASI_Mm01_00103690 predicted 222
7 SASI_Mm01_00103691 predicted 255
8 SASI_Mm01_00103692 predicted 288
9 SASI_Mm01_00103694 predicted 452
10 SASI_Mm01_00103695 predicted 456
11 SASI_Mm01_00103693 predicted 416
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011227
VALIDATED
RAB20 MISSION shRNA Bacterial Glycerol Stock
RAB20, member RAS oncogene family
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011227.1-291s1c1
Sequence:CCGGCCTGACAGAAACAGCCAACAACTCGAGTTGTTGGCTGTTTCTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011227.1-223s1c1
Sequence:CCGGGCTATCATCCTTACATACGATCTCGAGATCGTATGTAAGGATGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011227.1-570s1c1
Sequence:CCGGCCTCCTCTTTGAAACCTTGTTCTCGAGAACAAGGTTTCAAAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011227.1-474s1c1
Sequence:CCGGGAAGATCCTGAAGTACAAGATCTCGAGATCTTGTACTTCAGGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011227.1-464s1c1
Sequence:CCGGCCCTTTACAAGAAGATCCTGACTCGAGTCAGGATCTTCTTGTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011227.1-220s21c1
Sequence:GTACCGGGCCGCTATCATCCTTACATACCTCGAGGTATGTAAGGATGATAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011227.1-476s21c1
Sequence:GTACCGGAGATCCTGAAGTACAAGATGCCTCGAGGCATCTTGTACTTCAGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011227.1-450s21c1
Sequence:GTACCGGAGAGGATGCAGTGGCCCTTTACTCGAGTAAAGGGCCACTGCATCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011227
VALIDATED
RAB20 MISSION shRNA shRNA Plasmid DNA
RAB20, member RAS oncogene family
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011227.1-291s1c1
Sequence:CCGGCCTGACAGAAACAGCCAACAACTCGAGTTGTTGGCTGTTTCTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011227.1-223s1c1
Sequence:CCGGGCTATCATCCTTACATACGATCTCGAGATCGTATGTAAGGATGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011227.1-570s1c1
Sequence:CCGGCCTCCTCTTTGAAACCTTGTTCTCGAGAACAAGGTTTCAAAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011227.1-474s1c1
Sequence:CCGGGAAGATCCTGAAGTACAAGATCTCGAGATCTTGTACTTCAGGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011227.1-464s1c1
Sequence:CCGGCCCTTTACAAGAAGATCCTGACTCGAGTCAGGATCTTCTTGTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011227.1-220s21c1
Sequence:GTACCGGGCCGCTATCATCCTTACATACCTCGAGGTATGTAAGGATGATAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011227.1-476s21c1
Sequence:GTACCGGAGATCCTGAAGTACAAGATGCCTCGAGGCATCTTGTACTTCAGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011227.1-450s21c1
Sequence:GTACCGGAGAGGATGCAGTGGCCCTTTACTCGAGTAAAGGGCCACTGCATCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011227
VALIDATED
RAB20 MISSION shRNA Lentiviral Transduction Particles
RAB20, member RAS oncogene family
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011227.1-291s1c1
Sequence:CCGGCCTGACAGAAACAGCCAACAACTCGAGTTGTTGGCTGTTTCTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011227.1-223s1c1
Sequence:CCGGGCTATCATCCTTACATACGATCTCGAGATCGTATGTAAGGATGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011227.1-570s1c1
Sequence:CCGGCCTCCTCTTTGAAACCTTGTTCTCGAGAACAAGGTTTCAAAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011227.1-474s1c1
Sequence:CCGGGAAGATCCTGAAGTACAAGATCTCGAGATCTTGTACTTCAGGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011227.1-464s1c1
Sequence:CCGGCCCTTTACAAGAAGATCCTGACTCGAGTCAGGATCTTCTTGTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011227.1-220s21c1
Sequence:GTACCGGGCCGCTATCATCCTTACATACCTCGAGGTATGTAAGGATGATAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011227.1-476s21c1
Sequence:GTACCGGAGATCCTGAAGTACAAGATGCCTCGAGGCATCTTGTACTTCAGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011227.1-450s21c1
Sequence:GTACCGGAGAGGATGCAGTGGCCCTTTACTCGAGTAAAGGGCCACTGCATCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017817
RAB20 MISSION shRNA Bacterial Glycerol Stock
RAB20, member RAS oncogene family
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017817.1-852s1c1
Sequence:CCGGCAGTGGATATATCCAGTCATACTCGAGTATGACTGGATATATCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017817.1-727s1c1
Sequence:CCGGCGCTGAGCAAATGTGCTTTGACTCGAGTCAAAGCACATTTGCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017817.1-781s1c1
Sequence:CCGGCCTGTTTGAGACCCTCTTTGACTCGAGTCAAAGAGGGTCTCAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017817.1-331s1c1
Sequence:CCGGCCTGAAGCAGTGGCGCTCCTACTCGAGTAGGAGCGCCACTGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017817.1-442s1c1
Sequence:CCGGCTATGATGTGAATCACCGGCACTCGAGTGCCGGTGATTCACATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017817.1-1299s21c1
Sequence:GTACCGGCGTCCTACAACTCTGACATTTCTCGAGAAATGTCAGAGTTGTAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017817.1-1276s21c1
Sequence:GTACCGGTTCAGCACCCTGGGTTGTTACCTCGAGGTAACAACCCAGGGTGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017817.1-589s21c1
Sequence:GTACCGGGGAAGAGTGCAGTCCCAATATCTCGAGATATTGGGACTGCACTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017817.1-841s21c1
Sequence:GTACCGGGCCGTCACACACAGTGGATATCTCGAGATATCCACTGTGTGTGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017817.1-989s21c1
Sequence:GTACCGGAGGAACAGCAAGGAATTATTTCTCGAGAAATAATTCCTTGCTGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017817.1-963s21c1
Sequence:GTACCGGAGGCAAGCTGTGATCTGAAAGCTCGAGCTTTCAGATCACAGCTTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017817.1-895s21c1
Sequence:GTACCGGTGGGTGTTGTGCCTGACTTTCCTCGAGGAAAGTCAGGCACAACACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017817.1-435s21c1
Sequence:GTACCGGTCCTCACCTATGATGTGAATCCTCGAGGATTCACATCATAGGTGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017817.1-1028s21c1
Sequence:GTACCGGGCAGAATGTTGGAGTGGAAATCTCGAGATTTCCACTCCAACATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017817
RAB20 MISSION shRNA shRNA Plasmid DNA
RAB20, member RAS oncogene family
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017817.1-852s1c1
Sequence:CCGGCAGTGGATATATCCAGTCATACTCGAGTATGACTGGATATATCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017817.1-727s1c1
Sequence:CCGGCGCTGAGCAAATGTGCTTTGACTCGAGTCAAAGCACATTTGCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017817.1-781s1c1
Sequence:CCGGCCTGTTTGAGACCCTCTTTGACTCGAGTCAAAGAGGGTCTCAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017817.1-331s1c1
Sequence:CCGGCCTGAAGCAGTGGCGCTCCTACTCGAGTAGGAGCGCCACTGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017817.1-442s1c1
Sequence:CCGGCTATGATGTGAATCACCGGCACTCGAGTGCCGGTGATTCACATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017817.1-1299s21c1
Sequence:GTACCGGCGTCCTACAACTCTGACATTTCTCGAGAAATGTCAGAGTTGTAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017817.1-1276s21c1
Sequence:GTACCGGTTCAGCACCCTGGGTTGTTACCTCGAGGTAACAACCCAGGGTGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017817.1-589s21c1
Sequence:GTACCGGGGAAGAGTGCAGTCCCAATATCTCGAGATATTGGGACTGCACTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017817.1-841s21c1
Sequence:GTACCGGGCCGTCACACACAGTGGATATCTCGAGATATCCACTGTGTGTGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017817.1-989s21c1
Sequence:GTACCGGAGGAACAGCAAGGAATTATTTCTCGAGAAATAATTCCTTGCTGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017817.1-963s21c1
Sequence:GTACCGGAGGCAAGCTGTGATCTGAAAGCTCGAGCTTTCAGATCACAGCTTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017817.1-895s21c1
Sequence:GTACCGGTGGGTGTTGTGCCTGACTTTCCTCGAGGAAAGTCAGGCACAACACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017817.1-435s21c1
Sequence:GTACCGGTCCTCACCTATGATGTGAATCCTCGAGGATTCACATCATAGGTGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017817.1-1028s21c1
Sequence:GTACCGGGCAGAATGTTGGAGTGGAAATCTCGAGATTTCCACTCCAACATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017817
RAB20 MISSION shRNA Lentiviral Transduction Particles
RAB20, member RAS oncogene family
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017817.1-852s1c1
Sequence:CCGGCAGTGGATATATCCAGTCATACTCGAGTATGACTGGATATATCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017817.1-727s1c1
Sequence:CCGGCGCTGAGCAAATGTGCTTTGACTCGAGTCAAAGCACATTTGCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017817.1-781s1c1
Sequence:CCGGCCTGTTTGAGACCCTCTTTGACTCGAGTCAAAGAGGGTCTCAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017817.1-331s1c1
Sequence:CCGGCCTGAAGCAGTGGCGCTCCTACTCGAGTAGGAGCGCCACTGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017817.1-442s1c1
Sequence:CCGGCTATGATGTGAATCACCGGCACTCGAGTGCCGGTGATTCACATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017817.1-1299s21c1
Sequence:GTACCGGCGTCCTACAACTCTGACATTTCTCGAGAAATGTCAGAGTTGTAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017817.1-1276s21c1
Sequence:GTACCGGTTCAGCACCCTGGGTTGTTACCTCGAGGTAACAACCCAGGGTGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017817.1-589s21c1
Sequence:GTACCGGGGAAGAGTGCAGTCCCAATATCTCGAGATATTGGGACTGCACTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017817.1-841s21c1
Sequence:GTACCGGGCCGTCACACACAGTGGATATCTCGAGATATCCACTGTGTGTGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017817.1-989s21c1
Sequence:GTACCGGAGGAACAGCAAGGAATTATTTCTCGAGAAATAATTCCTTGCTGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017817.1-963s21c1
Sequence:GTACCGGAGGCAAGCTGTGATCTGAAAGCTCGAGCTTTCAGATCACAGCTTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017817.1-895s21c1
Sequence:GTACCGGTGGGTGTTGTGCCTGACTTTCCTCGAGGAAAGTCAGGCACAACACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017817.1-435s21c1
Sequence:GTACCGGTCCTCACCTATGATGTGAATCCTCGAGGATTCACATCATAGGTGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017817.1-1028s21c1
Sequence:GTACCGGGCAGAATGTTGGAGTGGAAATCTCGAGATTTCCACTCCAACATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks