EMAIL THIS PAGE TO A FRIEND

RAB37

RAB37, member RAS oncogene family

UniProtKB ID: Q96AX2, A8MXF5, A8MYT0, Q8IWA7
Gene ID:
Human(326624) Summary: Rab proteins are low molecular mass GTPases that are critical regulators of vesicle trafficking. For additional background information on Rab proteins, see MIM 179508.[supplied by OMIM, Apr 2006]
Mouse(58222) RAB37, member of RAS oncogene family
Rat(363704) RAB37, member of RAS oncogene family
dog(483298) RAB37, member RAS oncogene family
domestic cat(101090975) RAB37, member RAS oncogene family
naked mole-rat(101725741) RAB37, member RAS oncogene family
domestic guinea pig(100722516) RAB37, member RAS oncogene family
cow(613954) RAB37, member RAS oncogene family
sheep(101112582) RAB37, member RAS oncogene family
157 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0241 AQUA Peptide LQIWDTAGQE[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing
AQ0271 AQUA Peptide LQIWDTAGQE[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175738 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175738 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175738 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021411 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021411 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021411 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006637 Rosetta Predictions human pricing
NM_001006638 Rosetta Predictions human pricing
NM_175738 Rosetta Predictions human pricing
XM_343983 Rosetta Predictions rat pricing
NM_021411 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006637 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107973 predicted 464
2 SASI_Hs01_00107974 predicted 489
3 SASI_Hs01_00107975 predicted 497
4 SASI_Hs01_00107976 predicted 489
5 SASI_Hs01_00107977 predicted 521
6 SASI_Hs01_00107978 predicted 488
7 SASI_Hs01_00107979 predicted 481
8 SASI_Hs01_00107980 predicted 469
9 SASI_Hs01_00107981 predicted 532
10 SASI_Hs01_00107982 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006638 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067524 predicted 459
2 SASI_Hs01_00067525 predicted 483
3 SASI_Hs01_00067526 predicted 498
4 SASI_Hs01_00067527 predicted 483
5 SASI_Hs01_00067528 predicted 524
6 SASI_Hs01_00067529 predicted 477
7 SASI_Hs01_00067530 predicted 473
8 SASI_Hs01_00067532 predicted 523
9 SASI_Hs01_00067533 predicted 456
10 SASI_Hs02_00305104 predicted 479
11 SASI_Hs01_00067531 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175738 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143927 predicted 835
2 SASI_Hs01_00143928 predicted 861
3 SASI_Hs01_00143929 predicted 880
4 SASI_Hs01_00143930 predicted 861
5 SASI_Hs01_00143931 predicted 903
6 SASI_Hs01_00143932 predicted 864
7 SASI_Hs01_00143933 predicted 852
8 SASI_Hs01_00143935 predicted 904
9 SASI_Hs01_00143936 predicted 836
10 SASI_Hs02_00369083 predicted 866
11 SASI_Hs01_00143934 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343983 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00192623 predicted 303
2 SASI_Rn01_00192624 predicted 385
3 SASI_Rn01_00192625 predicted 206
4 SASI_Rn01_00192626 predicted 554
5 SASI_Rn01_00192627 predicted 323
6 SASI_Rn01_00192628 predicted 424
7 SASI_Rn01_00192629 predicted 452
8 SASI_Rn01_00192630 predicted 614
9 SASI_Rn01_00192631 predicted 416
10 SASI_Rn01_00192632 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021411 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102205 predicted 984
2 SASI_Mm01_00102207 predicted 1178
3 SASI_Mm01_00102208 predicted 824
4 SASI_Mm02_00326045 predicted 982
5 SASI_Mm01_00102209 predicted 792
6 SASI_Mm01_00102210 predicted 829
7 SASI_Mm02_00326046 predicted 797
8 SASI_Mm02_00326047 predicted 834
9 SASI_Mm01_00102212 predicted 561
10 SASI_Mm02_00326048 predicted 422
11 SASI_Mm01_00102204 predicted 1184
12 SASI_Mm01_00102206 predicted 324
13 SASI_Mm01_00102211 predicted 851
14 SASI_Mm01_00102213 predicted 861
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175738
VALIDATED
RAB37 MISSION shRNA Bacterial Glycerol Stock
RAB37, member RAS oncogene family
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_175738.2-878s1c1
Sequence:CCGGGCAGCGAAAGAGTGATCCGTTCTCGAGAACGGATCACTCTTTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175738.2-774s1c1
Sequence:CCGGCAACAAATCTTCTTTCGACAACTCGAGTTGTCGAAAGAAGATTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_175738.2-711s1c1
Sequence:CCGGCCGAAGCGTCACCCATGCTTACTCGAGTAAGCATGGGTGACGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_175738.2-1059s1c1
Sequence:CCGGCTATGTAGAGTCCCAGAAGAACTCGAGTTCTTCTGGGACTCTACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_175738.2-1042s1c1
Sequence:CCGGAGCTTCCAGATCCGAGACTATCTCGAGATAGTCTCGGATCTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175738.4-638s21c1
Sequence:GTACCGGGGGCATCGGATTCACGAACAACTCGAGTTGTTCGTGAATCCGATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175738.4-869s21c1
Sequence:GTACCGGGCTAGGCAACAAGGCGGATATCTCGAGATATCCGCCTTGTTGCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175738.4-1007s21c1
Sequence:GTACCGGCATCGCCAAGGAACTGAAATACTCGAGTATTTCAGTTCCTTGGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175738.4-775s21c1
Sequence:GTACCGGTGTATGACATCACCAACAAATCTCGAGATTTGTTGGTGATGTCATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175738.4-1587s21c1
Sequence:GTACCGGCGCTCTCCAGGAGCTTATCTTCTCGAGAAGATAAGCTCCTGGAGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175738.4-729s21c1
Sequence:GTACCGGAGCGTCACCCATGCTTATTACCTCGAGGTAATAAGCATGGGTGACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175738
VALIDATED
RAB37 MISSION shRNA shRNA Plasmid DNA
RAB37, member RAS oncogene family
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_175738.2-878s1c1
Sequence:CCGGGCAGCGAAAGAGTGATCCGTTCTCGAGAACGGATCACTCTTTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175738.2-774s1c1
Sequence:CCGGCAACAAATCTTCTTTCGACAACTCGAGTTGTCGAAAGAAGATTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_175738.2-711s1c1
Sequence:CCGGCCGAAGCGTCACCCATGCTTACTCGAGTAAGCATGGGTGACGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_175738.2-1059s1c1
Sequence:CCGGCTATGTAGAGTCCCAGAAGAACTCGAGTTCTTCTGGGACTCTACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_175738.2-1042s1c1
Sequence:CCGGAGCTTCCAGATCCGAGACTATCTCGAGATAGTCTCGGATCTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175738.4-638s21c1
Sequence:GTACCGGGGGCATCGGATTCACGAACAACTCGAGTTGTTCGTGAATCCGATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175738.4-869s21c1
Sequence:GTACCGGGCTAGGCAACAAGGCGGATATCTCGAGATATCCGCCTTGTTGCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175738.4-1007s21c1
Sequence:GTACCGGCATCGCCAAGGAACTGAAATACTCGAGTATTTCAGTTCCTTGGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175738.4-775s21c1
Sequence:GTACCGGTGTATGACATCACCAACAAATCTCGAGATTTGTTGGTGATGTCATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175738.4-1587s21c1
Sequence:GTACCGGCGCTCTCCAGGAGCTTATCTTCTCGAGAAGATAAGCTCCTGGAGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175738.4-729s21c1
Sequence:GTACCGGAGCGTCACCCATGCTTATTACCTCGAGGTAATAAGCATGGGTGACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175738
VALIDATED
RAB37 MISSION shRNA Lentiviral Transduction Particles
RAB37, member RAS oncogene family
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_175738.2-878s1c1
Sequence:CCGGGCAGCGAAAGAGTGATCCGTTCTCGAGAACGGATCACTCTTTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175738.2-774s1c1
Sequence:CCGGCAACAAATCTTCTTTCGACAACTCGAGTTGTCGAAAGAAGATTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_175738.2-711s1c1
Sequence:CCGGCCGAAGCGTCACCCATGCTTACTCGAGTAAGCATGGGTGACGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_175738.2-1059s1c1
Sequence:CCGGCTATGTAGAGTCCCAGAAGAACTCGAGTTCTTCTGGGACTCTACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_175738.2-1042s1c1
Sequence:CCGGAGCTTCCAGATCCGAGACTATCTCGAGATAGTCTCGGATCTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175738.4-638s21c1
Sequence:GTACCGGGGGCATCGGATTCACGAACAACTCGAGTTGTTCGTGAATCCGATGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175738.4-869s21c1
Sequence:GTACCGGGCTAGGCAACAAGGCGGATATCTCGAGATATCCGCCTTGTTGCCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175738.4-1007s21c1
Sequence:GTACCGGCATCGCCAAGGAACTGAAATACTCGAGTATTTCAGTTCCTTGGCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175738.4-775s21c1
Sequence:GTACCGGTGTATGACATCACCAACAAATCTCGAGATTTGTTGGTGATGTCATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175738.4-1587s21c1
Sequence:GTACCGGCGCTCTCCAGGAGCTTATCTTCTCGAGAAGATAAGCTCCTGGAGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175738.4-729s21c1
Sequence:GTACCGGAGCGTCACCCATGCTTATTACCTCGAGGTAATAAGCATGGGTGACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021411
RAB37 MISSION shRNA Bacterial Glycerol Stock
RAB37, member RAS oncogene family
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021411.2-1541s1c1
Sequence:CCGGGCAGAACTGAACAAAGCCATACTCGAGTATGGCTTTGTTCAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021411.2-409s1c1
Sequence:CCGGGCCCAGAGAGACGTGGTGATTCTCGAGAATCACCACGTCTCTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021411.2-204s1c1
Sequence:CCGGCGGCATAGACTCCAGGAATAACTCGAGTTATTCCTGGAGTCTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021411.2-418s1c1
Sequence:CCGGGACGTGGTGATTATGCTTCTACTCGAGTAGAAGCATAATCACCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021411.2-500s1c1
Sequence:CCGGCCAGGGAATATGGTGTTCCTTCTCGAGAAGGAACACCATATTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021411.4-1163s21c1
Sequence:GTACCGGCCAAAGCCTTGGGCAAGATAACTCGAGTTATCTTGCCCAAGGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021411.4-298s21c1
Sequence:GTACCGGCGCAGTGTGACCCATGCTTATCTCGAGATAAGCATGGGTCACACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021411.4-444s21c1
Sequence:GTACCGGAGGCAACAAGGCCGATGTAAGCTCGAGCTTACATCGGCCTTGTTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021411.4-629s21c1
Sequence:GTACCGGGCTTCCAGATCCGAGACTATGCTCGAGCATAGTCTCGGATCTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021411
RAB37 MISSION shRNA shRNA Plasmid DNA
RAB37, member RAS oncogene family
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021411.2-1541s1c1
Sequence:CCGGGCAGAACTGAACAAAGCCATACTCGAGTATGGCTTTGTTCAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021411.2-409s1c1
Sequence:CCGGGCCCAGAGAGACGTGGTGATTCTCGAGAATCACCACGTCTCTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021411.2-204s1c1
Sequence:CCGGCGGCATAGACTCCAGGAATAACTCGAGTTATTCCTGGAGTCTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021411.2-418s1c1
Sequence:CCGGGACGTGGTGATTATGCTTCTACTCGAGTAGAAGCATAATCACCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021411.2-500s1c1
Sequence:CCGGCCAGGGAATATGGTGTTCCTTCTCGAGAAGGAACACCATATTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021411.4-1163s21c1
Sequence:GTACCGGCCAAAGCCTTGGGCAAGATAACTCGAGTTATCTTGCCCAAGGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021411.4-298s21c1
Sequence:GTACCGGCGCAGTGTGACCCATGCTTATCTCGAGATAAGCATGGGTCACACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021411.4-444s21c1
Sequence:GTACCGGAGGCAACAAGGCCGATGTAAGCTCGAGCTTACATCGGCCTTGTTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021411.4-629s21c1
Sequence:GTACCGGGCTTCCAGATCCGAGACTATGCTCGAGCATAGTCTCGGATCTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021411
RAB37 MISSION shRNA Lentiviral Transduction Particles
RAB37, member RAS oncogene family
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021411.2-1541s1c1
Sequence:CCGGGCAGAACTGAACAAAGCCATACTCGAGTATGGCTTTGTTCAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021411.2-409s1c1
Sequence:CCGGGCCCAGAGAGACGTGGTGATTCTCGAGAATCACCACGTCTCTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021411.2-204s1c1
Sequence:CCGGCGGCATAGACTCCAGGAATAACTCGAGTTATTCCTGGAGTCTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021411.2-418s1c1
Sequence:CCGGGACGTGGTGATTATGCTTCTACTCGAGTAGAAGCATAATCACCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021411.2-500s1c1
Sequence:CCGGCCAGGGAATATGGTGTTCCTTCTCGAGAAGGAACACCATATTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021411.4-1163s21c1
Sequence:GTACCGGCCAAAGCCTTGGGCAAGATAACTCGAGTTATCTTGCCCAAGGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021411.4-298s21c1
Sequence:GTACCGGCGCAGTGTGACCCATGCTTATCTCGAGATAAGCATGGGTCACACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021411.4-444s21c1
Sequence:GTACCGGAGGCAACAAGGCCGATGTAAGCTCGAGCTTACATCGGCCTTGTTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021411.4-629s21c1
Sequence:GTACCGGGCTTCCAGATCCGAGACTATGCTCGAGCATAGTCTCGGATCTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks