EMAIL THIS PAGE TO A FRIEND

RAB40B

RAB40B, member RAS oncogene family

Synonyms: RAR SEC4L
UniProtKB ID: Q12829, Q8WVG3
Gene ID:
Human(10966) Summary: The protein encoded by this gene has similarity to a yeast protein which suggests a role of the gene product in regulating secretory vesicles. [provided by RefSeq, Jul 2008]
Mouse(217371) Rab40b, member RAS oncogene family
Rat(303754) Rab40b, member RAS oncogene family
Zebrafish(436797) RAB40B, member RAS oncogene family
domestic cat(101083559) RAB40B, member RAS oncogene family
chicken(417338) RAB40B, member RAS oncogene family
cow(534237) RAB40B, member RAS oncogene family
sheep(101104257) RAB40B, member RAS oncogene family
naked mole-rat(101708731) RAB40B, member RAS oncogene family
domestic guinea pig(100717623) RAB40B, member RAS oncogene family
104 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006822 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006822 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006822 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139147 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139147 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139147 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006822 Rosetta Predictions human pricing
NM_001107076 Rosetta Predictions rat pricing
NM_139147 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006822 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150368 predicted 1375
2 SASI_Hs01_00150369 predicted 1251
3 SASI_Hs01_00150370 predicted 1130
4 SASI_Hs01_00150371 predicted 1134
5 SASI_Hs01_00150372 predicted 1345
6 SASI_Hs01_00150373 predicted 1363
7 SASI_Hs01_00150374 predicted 1343
8 SASI_Hs01_00150375 predicted 247
9 SASI_Hs01_00150376 predicted 1108
10 SASI_Hs01_00150377 predicted 1116
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107076 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225256 predicted 1277
2 SASI_Rn02_00225257 predicted 1449
3 SASI_Rn02_00225258 predicted 1430
4 SASI_Rn02_00225259 predicted 853
5 SASI_Rn02_00225260 predicted 1408
6 SASI_Rn02_00225261 predicted 586
7 SASI_Rn02_00225262 predicted 341
8 SASI_Rn02_00225263 predicted 760
9 SASI_Rn02_00225264 predicted 284
10 SASI_Rn02_00225265 predicted 406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139147 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188389 predicted 1146
2 SASI_Mm01_00188390 predicted 748
3 SASI_Mm01_00188391 predicted 757
4 SASI_Mm01_00188392 predicted 1299
5 SASI_Mm02_00339894 predicted 665
6 SASI_Mm01_00188394 predicted 424
7 SASI_Mm01_00188395 predicted 1293
8 SASI_Mm01_00188396 predicted 332
9 SASI_Mm02_00339895 predicted 558
10 SASI_Mm02_00339896 predicted 1134
11 SASI_Mm01_00188393 predicted 1025
12 SASI_Mm01_00188397 predicted 1406
13 SASI_Mm01_00188398 predicted 752
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006822
VALIDATED
RAB40B MISSION shRNA Bacterial Glycerol Stock
RAB40B, member RAS oncogene family
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006822.1-1121s1c1
Sequence:CCGGCGACTCTTGGTAACATGAAATCTCGAGATTTCATGTTACCAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006822.1-354s1c1
Sequence:CCGGCGGCATTGATCGATGGATTAACTCGAGTTAATCCATCGATCAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006822.1-743s1c1
Sequence:CCGGCCAGGATGATGCACGGCGGTTCTCGAGAACCGCCGTGCATCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006822.1-513s1c1
Sequence:CCGGCCCTCTGTGCAATTTCAACATCTCGAGATGTTGAAATTGCACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006822.1-243s1c1
Sequence:CCGGGCTCTGGGATACTTCAGGCCACTCGAGTGGCCTGAAGTATCCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006822.2-824s21c1
Sequence:CCGGCCAGGATGATGCACGGCGGTTCTCGAGAACCGCCGTGCATCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006822.2-334s21c1
Sequence:CCGGACTTCAGGCCAGGGAAGATTTCTCGAGAAATCTTCCCTGGCCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006822.2-959s21c1
Sequence:CCGGCTTAAGGAAGGCACTGAAAGACTCGAGTCTTTCAGTGCCTTCCTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006822.2-435s21c1
Sequence:CCGGCGGCATTGATCGATGGATTAACTCGAGTTAATCCATCGATCAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380874    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006822.2-1061s21c1
Sequence:GTACCGGGCGAATGCTGCTTGCGAATGTCTCGAGACATTCGCAAGCAGCATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006822.2-1427s21c1
Sequence:GTACCGGGCTGCAGATGTAGAGGTTATGCTCGAGCATAACCTCTACATCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006822
VALIDATED
RAB40B MISSION shRNA shRNA Plasmid DNA
RAB40B, member RAS oncogene family
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006822.1-1121s1c1
Sequence:CCGGCGACTCTTGGTAACATGAAATCTCGAGATTTCATGTTACCAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006822.1-354s1c1
Sequence:CCGGCGGCATTGATCGATGGATTAACTCGAGTTAATCCATCGATCAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006822.1-743s1c1
Sequence:CCGGCCAGGATGATGCACGGCGGTTCTCGAGAACCGCCGTGCATCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006822.1-513s1c1
Sequence:CCGGCCCTCTGTGCAATTTCAACATCTCGAGATGTTGAAATTGCACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006822.1-243s1c1
Sequence:CCGGGCTCTGGGATACTTCAGGCCACTCGAGTGGCCTGAAGTATCCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006822.2-824s21c1
Sequence:CCGGCCAGGATGATGCACGGCGGTTCTCGAGAACCGCCGTGCATCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006822.2-334s21c1
Sequence:CCGGACTTCAGGCCAGGGAAGATTTCTCGAGAAATCTTCCCTGGCCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006822.2-959s21c1
Sequence:CCGGCTTAAGGAAGGCACTGAAAGACTCGAGTCTTTCAGTGCCTTCCTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006822.2-435s21c1
Sequence:CCGGCGGCATTGATCGATGGATTAACTCGAGTTAATCCATCGATCAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380874    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006822.2-1061s21c1
Sequence:GTACCGGGCGAATGCTGCTTGCGAATGTCTCGAGACATTCGCAAGCAGCATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006822.2-1427s21c1
Sequence:GTACCGGGCTGCAGATGTAGAGGTTATGCTCGAGCATAACCTCTACATCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006822
VALIDATED
RAB40B MISSION shRNA Lentiviral Transduction Particles
RAB40B, member RAS oncogene family
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006822.1-1121s1c1
Sequence:CCGGCGACTCTTGGTAACATGAAATCTCGAGATTTCATGTTACCAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006822.1-354s1c1
Sequence:CCGGCGGCATTGATCGATGGATTAACTCGAGTTAATCCATCGATCAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006822.1-743s1c1
Sequence:CCGGCCAGGATGATGCACGGCGGTTCTCGAGAACCGCCGTGCATCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006822.1-513s1c1
Sequence:CCGGCCCTCTGTGCAATTTCAACATCTCGAGATGTTGAAATTGCACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006822.1-243s1c1
Sequence:CCGGGCTCTGGGATACTTCAGGCCACTCGAGTGGCCTGAAGTATCCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006822.2-824s21c1
Sequence:CCGGCCAGGATGATGCACGGCGGTTCTCGAGAACCGCCGTGCATCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006822.2-334s21c1
Sequence:CCGGACTTCAGGCCAGGGAAGATTTCTCGAGAAATCTTCCCTGGCCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006822.2-959s21c1
Sequence:CCGGCTTAAGGAAGGCACTGAAAGACTCGAGTCTTTCAGTGCCTTCCTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006822.2-435s21c1
Sequence:CCGGCGGCATTGATCGATGGATTAACTCGAGTTAATCCATCGATCAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380874    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006822.2-1061s21c1
Sequence:GTACCGGGCGAATGCTGCTTGCGAATGTCTCGAGACATTCGCAAGCAGCATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380785    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006822.2-1427s21c1
Sequence:GTACCGGGCTGCAGATGTAGAGGTTATGCTCGAGCATAACCTCTACATCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139147
RAB40B MISSION shRNA Bacterial Glycerol Stock
RAB40B, member RAS oncogene family
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102765    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139147.2-1152s1c1
Sequence:CCGGGCATTTATTAACGGTAACGATCTCGAGATCGTTACCGTTAATAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139147.2-766s1c1
Sequence:CCGGCCACCTTAAGTCTTTCTCGATCTCGAGATCGAGAAAGACTTAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139147.2-374s1c1
Sequence:CCGGGTGGTCCTGGTCTATGACATTCTCGAGAATGTCATAGACCAGGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139147.2-586s1c1
Sequence:CCGGCTTCAACATTACAGAGTCCTTCTCGAGAAGGACTCTGTAATGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139147.2-425s1c1
Sequence:CCGGCGATGGATTAAGGAGATTGATCTCGAGATCAATCTCCTTAATCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139147.3-285s21c1
Sequence:GTACCGGTAGATGGCCGAAGGGTGAAACCTCGAGGTTTCACCCTTCGGCCATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139147.3-341s21c1
Sequence:GTACCGGTGTACCATATTCCGCTCATACCTCGAGGTATGAGCGGAATATGGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139147
RAB40B MISSION shRNA shRNA Plasmid DNA
RAB40B, member RAS oncogene family
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102765    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139147.2-1152s1c1
Sequence:CCGGGCATTTATTAACGGTAACGATCTCGAGATCGTTACCGTTAATAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139147.2-766s1c1
Sequence:CCGGCCACCTTAAGTCTTTCTCGATCTCGAGATCGAGAAAGACTTAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139147.2-374s1c1
Sequence:CCGGGTGGTCCTGGTCTATGACATTCTCGAGAATGTCATAGACCAGGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139147.2-586s1c1
Sequence:CCGGCTTCAACATTACAGAGTCCTTCTCGAGAAGGACTCTGTAATGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139147.2-425s1c1
Sequence:CCGGCGATGGATTAAGGAGATTGATCTCGAGATCAATCTCCTTAATCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139147.3-285s21c1
Sequence:GTACCGGTAGATGGCCGAAGGGTGAAACCTCGAGGTTTCACCCTTCGGCCATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139147.3-341s21c1
Sequence:GTACCGGTGTACCATATTCCGCTCATACCTCGAGGTATGAGCGGAATATGGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139147
RAB40B MISSION shRNA Lentiviral Transduction Particles
RAB40B, member RAS oncogene family
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102765    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139147.2-1152s1c1
Sequence:CCGGGCATTTATTAACGGTAACGATCTCGAGATCGTTACCGTTAATAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139147.2-766s1c1
Sequence:CCGGCCACCTTAAGTCTTTCTCGATCTCGAGATCGAGAAAGACTTAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139147.2-374s1c1
Sequence:CCGGGTGGTCCTGGTCTATGACATTCTCGAGAATGTCATAGACCAGGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139147.2-586s1c1
Sequence:CCGGCTTCAACATTACAGAGTCCTTCTCGAGAAGGACTCTGTAATGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139147.2-425s1c1
Sequence:CCGGCGATGGATTAAGGAGATTGATCTCGAGATCAATCTCCTTAATCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139147.3-285s21c1
Sequence:GTACCGGTAGATGGCCGAAGGGTGAAACCTCGAGGTTTCACCCTTCGGCCATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139147.3-341s21c1
Sequence:GTACCGGTGTACCATATTCCGCTCATACCTCGAGGTATGAGCGGAATATGGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks