EMAIL THIS PAGE TO A FRIEND

RAB5B

RAB5B, member RAS oncogene family

Gene ID:
Mouse(19344) RAB5B, member RAS oncogene family
Rat(288779) RAB5B, member RAS oncogene family
domestic guinea pig(100714048) RAB5B, member RAS oncogene family
naked mole-rat(101724150) RAB5B, member RAS oncogene family
cow(539150) RAB5B, member RAS oncogene family
sheep(101112211) RAB5B, member RAS oncogene family
Zebrafish(405821) RAB5B, member RAS oncogene family
chicken(100529061) RAB5B, member RAS oncogene family
dog(474394) RAB5B, member RAS oncogene family
domestic cat(101093783) RAB5B, member RAS oncogene family
225 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002868 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002868 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002868 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177411 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177411 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177411 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002868 Rosetta Predictions human pricing
NM_001079936 Rosetta Predictions rat pricing
NM_011229 Rosetta Predictions mouse pricing
NM_177411 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002868 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227499 predicted 438
2 SASI_Hs01_00227500 predicted 652
3 SASI_Hs02_00334642 predicted 845
4 SASI_Hs01_00227501 predicted 603
5 SASI_Hs01_00227502 predicted 442
6 SASI_Hs01_00227503 predicted 766
7 SASI_Hs01_00227504 predicted 469
8 SASI_Hs01_00227505 predicted 816
9 SASI_Hs01_00227506 predicted 649
10 SASI_Hs01_00227507 predicted 501
11 SASI_Hs01_00227508 predicted 1052
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079936 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208309 predicted 557
2 SASI_Rn02_00208310 predicted 950
3 SASI_Rn02_00208311 predicted 673
4 SASI_Rn02_00208312 predicted 882
5 SASI_Rn02_00208313 predicted 941
6 SASI_Rn02_00208314 predicted 928
7 SASI_Rn02_00208315 predicted 752
8 SASI_Rn02_00208316 predicted 1163
9 SASI_Rn02_00208317 predicted 764
10 SASI_Rn02_00208318 predicted 591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011229 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163125 predicted 363
2 SASI_Mm01_00163126 predicted 464
3 SASI_Mm01_00163127 predicted 286
4 SASI_Mm01_00163128 predicted 481
5 SASI_Mm01_00163129 predicted 455
6 SASI_Mm01_00163130 predicted 369
7 SASI_Mm01_00163131 predicted 413
8 SASI_Mm01_00163132 predicted 464
9 SASI_Mm01_00163133 predicted 329
10 SASI_Mm01_00163134 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177411 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103572 predicted 484
2 SASI_Mm01_00103573 predicted 590
3 SASI_Mm01_00103574 predicted 407
4 SASI_Mm01_00103575 predicted 603
5 SASI_Mm01_00103576 predicted 581
6 SASI_Mm01_00103577 predicted 498
7 SASI_Mm01_00103578 predicted 547
8 SASI_Mm01_00103579 predicted 589
9 SASI_Mm01_00103580 predicted 462
10 SASI_Mm01_00103581 predicted 496
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002868
VALIDATED
RAB5B MISSION shRNA Bacterial Glycerol Stock
RAB5B, member RAS oncogene family
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002868.2-1259s21c1
Sequence:GTACCGGAGGAGGTTTCCAGTTCATTTACTCGAGTAAATGAACTGGAAACCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002868.2-278s21c1
Sequence:GTACCGGCAAAGGGCAGTTCCATGAGTACTCGAGTACTCATGGAACTGCCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002868.2-442s21c1
Sequence:GTACCGGCAATCGTGGTTTACGACATTACTCGAGTAATGTCGTAAACCACGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002868.2-519s21c1
Sequence:CCGGGCCAGTCCTAGCATCGTTATTCTCGAGAATAACGATGCTAGGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_002868.2-1081s21c1
Sequence:CCGGAGGTACAAGACAGCGACTTACCTCGAGGTAAGTCGCTGTCTTGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002868.2-609s21c1
Sequence:CCGGGCAGATGACAACAGCTTATTGCTCGAGCAATAAGCTGTTGTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002868.2-250s21c1
Sequence:CCGGGAAAGTCAAGCCTGGTATTACCTCGAGGTAATACCAGGCTTGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002868.2-561s21c1
Sequence:CCGGGACCTGGCCAACAAACGTATGCTCGAGCATACGTTTGTTGGCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002868.2-221s21c1
Sequence:GTACCGGATTGGTCCTGCTGGGAGAATCCTCGAGGATTCTCCCAGCAGGACCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002868.2-391s21c1
Sequence:GTACCGGAGGAGCGATATCACAGCTTAGCTCGAGCTAAGCTGTGATATCGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002868.2-434s1c1
Sequence:CCGGCCAAGCTGCAATCGTGGTTTACTCGAGTAAACCACGATTGCAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002868.2-519s1c1
Sequence:CCGGGCCAGTCCTAGCATCGTTATTCTCGAGAATAACGATGCTAGGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_002868.2-651s1c1
Sequence:CCGGACAGCTATGAACGTGAATGATCTCGAGATCATTCACGTTCATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002868.2-482s1c1
Sequence:CCGGCCGAGCAAAGACATGGGTGAACTCGAGTTCACCCATGTCTTTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_002868.2-337s1c1
Sequence:CCGGCCGTTTGTCTAGATGACACAACTCGAGTTGTGTCATCTAGACAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002868
VALIDATED
RAB5B MISSION shRNA shRNA Plasmid DNA
RAB5B, member RAS oncogene family
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002868.2-1259s21c1
Sequence:GTACCGGAGGAGGTTTCCAGTTCATTTACTCGAGTAAATGAACTGGAAACCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002868.2-278s21c1
Sequence:GTACCGGCAAAGGGCAGTTCCATGAGTACTCGAGTACTCATGGAACTGCCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002868.2-442s21c1
Sequence:GTACCGGCAATCGTGGTTTACGACATTACTCGAGTAATGTCGTAAACCACGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002868.2-519s21c1
Sequence:CCGGGCCAGTCCTAGCATCGTTATTCTCGAGAATAACGATGCTAGGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_002868.2-1081s21c1
Sequence:CCGGAGGTACAAGACAGCGACTTACCTCGAGGTAAGTCGCTGTCTTGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002868.2-609s21c1
Sequence:CCGGGCAGATGACAACAGCTTATTGCTCGAGCAATAAGCTGTTGTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002868.2-250s21c1
Sequence:CCGGGAAAGTCAAGCCTGGTATTACCTCGAGGTAATACCAGGCTTGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002868.2-561s21c1
Sequence:CCGGGACCTGGCCAACAAACGTATGCTCGAGCATACGTTTGTTGGCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002868.2-221s21c1
Sequence:GTACCGGATTGGTCCTGCTGGGAGAATCCTCGAGGATTCTCCCAGCAGGACCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002868.2-391s21c1
Sequence:GTACCGGAGGAGCGATATCACAGCTTAGCTCGAGCTAAGCTGTGATATCGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002868.2-434s1c1
Sequence:CCGGCCAAGCTGCAATCGTGGTTTACTCGAGTAAACCACGATTGCAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002868.2-519s1c1
Sequence:CCGGGCCAGTCCTAGCATCGTTATTCTCGAGAATAACGATGCTAGGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_002868.2-651s1c1
Sequence:CCGGACAGCTATGAACGTGAATGATCTCGAGATCATTCACGTTCATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002868.2-482s1c1
Sequence:CCGGCCGAGCAAAGACATGGGTGAACTCGAGTTCACCCATGTCTTTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_002868.2-337s1c1
Sequence:CCGGCCGTTTGTCTAGATGACACAACTCGAGTTGTGTCATCTAGACAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002868
VALIDATED
RAB5B MISSION shRNA Lentiviral Transduction Particles
RAB5B, member RAS oncogene family
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002868.2-1259s21c1
Sequence:GTACCGGAGGAGGTTTCCAGTTCATTTACTCGAGTAAATGAACTGGAAACCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002868.2-278s21c1
Sequence:GTACCGGCAAAGGGCAGTTCCATGAGTACTCGAGTACTCATGGAACTGCCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002868.2-442s21c1
Sequence:GTACCGGCAATCGTGGTTTACGACATTACTCGAGTAATGTCGTAAACCACGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002868.2-519s21c1
Sequence:CCGGGCCAGTCCTAGCATCGTTATTCTCGAGAATAACGATGCTAGGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_002868.2-1081s21c1
Sequence:CCGGAGGTACAAGACAGCGACTTACCTCGAGGTAAGTCGCTGTCTTGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002868.2-609s21c1
Sequence:CCGGGCAGATGACAACAGCTTATTGCTCGAGCAATAAGCTGTTGTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002868.2-250s21c1
Sequence:CCGGGAAAGTCAAGCCTGGTATTACCTCGAGGTAATACCAGGCTTGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002868.2-561s21c1
Sequence:CCGGGACCTGGCCAACAAACGTATGCTCGAGCATACGTTTGTTGGCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002868.2-221s21c1
Sequence:GTACCGGATTGGTCCTGCTGGGAGAATCCTCGAGGATTCTCCCAGCAGGACCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002868.2-391s21c1
Sequence:GTACCGGAGGAGCGATATCACAGCTTAGCTCGAGCTAAGCTGTGATATCGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002868.2-434s1c1
Sequence:CCGGCCAAGCTGCAATCGTGGTTTACTCGAGTAAACCACGATTGCAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002868.2-519s1c1
Sequence:CCGGGCCAGTCCTAGCATCGTTATTCTCGAGAATAACGATGCTAGGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_002868.2-651s1c1
Sequence:CCGGACAGCTATGAACGTGAATGATCTCGAGATCATTCACGTTCATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002868.2-482s1c1
Sequence:CCGGCCGAGCAAAGACATGGGTGAACTCGAGTTCACCCATGTCTTTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_002868.2-337s1c1
Sequence:CCGGCCGTTTGTCTAGATGACACAACTCGAGTTGTGTCATCTAGACAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177411
RAB5B MISSION shRNA Bacterial Glycerol Stock
RAB5B, member RAS oncogene family
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177411.4-614s21c1
Sequence:GTACCGGTATGAAGAGGCTCAGGCATATCTCGAGATATGCCTGAGCCTCTTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177411.4-276s21c1
Sequence:GTACCGGGGAAGTCTAGCCTGGTGTTACCTCGAGGTAACACCAGGCTAGACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177411.4-508s21c1
Sequence:CCGGTCGGGCAAAGACATGGGTAAACTCGAGTTTACCCATGTCTTTGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177411.4-675s21c1
Sequence:CCGGAGACTGCTATGAACGTGAATGCTCGAGCATTCACGTTCATAGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177411.4-304s21c1
Sequence:CCGGCAAAGGACAGTTCCATGAATACTCGAGTATTCATGGAACTGTCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177411.4-544s21c1
Sequence:CCGGAGCCAGCCCTAGCATTGTTATCTCGAGATAACAATGCTAGGGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177411.4-1766s21c1
Sequence:CCGGGCACTTTAATTGATGGTAGTTCTCGAGAACTACCATCAATTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177411.2-1760s1c1
Sequence:CCGGGCACTTTAATTGATGGTAGTTCTCGAGAACTACCATCAATTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177411.2-359s1c1
Sequence:CCGGCCGTGTGTTTAGATGACACAACTCGAGTTGTGTCATCTAAACACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177411.2-631s1c1
Sequence:CCGGGCAGATGACAACAGCTTATTACTCGAGTAATAAGCTGTTGTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177411.2-468s1c1
Sequence:CCGGCGTGGTCTATGATATTACTAACTCGAGTTAGTAATATCATAGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177411.2-699s1c1
Sequence:CCGGCCTGGCAATAGCAAAGAAGTTCTCGAGAACTTCTTTGCTATTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177411
RAB5B MISSION shRNA shRNA Plasmid DNA
RAB5B, member RAS oncogene family
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177411.4-614s21c1
Sequence:GTACCGGTATGAAGAGGCTCAGGCATATCTCGAGATATGCCTGAGCCTCTTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177411.4-276s21c1
Sequence:GTACCGGGGAAGTCTAGCCTGGTGTTACCTCGAGGTAACACCAGGCTAGACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177411.4-508s21c1
Sequence:CCGGTCGGGCAAAGACATGGGTAAACTCGAGTTTACCCATGTCTTTGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177411.4-675s21c1
Sequence:CCGGAGACTGCTATGAACGTGAATGCTCGAGCATTCACGTTCATAGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177411.4-304s21c1
Sequence:CCGGCAAAGGACAGTTCCATGAATACTCGAGTATTCATGGAACTGTCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177411.4-544s21c1
Sequence:CCGGAGCCAGCCCTAGCATTGTTATCTCGAGATAACAATGCTAGGGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177411.4-1766s21c1
Sequence:CCGGGCACTTTAATTGATGGTAGTTCTCGAGAACTACCATCAATTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177411.2-1760s1c1
Sequence:CCGGGCACTTTAATTGATGGTAGTTCTCGAGAACTACCATCAATTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177411.2-359s1c1
Sequence:CCGGCCGTGTGTTTAGATGACACAACTCGAGTTGTGTCATCTAAACACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177411.2-631s1c1
Sequence:CCGGGCAGATGACAACAGCTTATTACTCGAGTAATAAGCTGTTGTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177411.2-468s1c1
Sequence:CCGGCGTGGTCTATGATATTACTAACTCGAGTTAGTAATATCATAGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177411.2-699s1c1
Sequence:CCGGCCTGGCAATAGCAAAGAAGTTCTCGAGAACTTCTTTGCTATTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177411
RAB5B MISSION shRNA Lentiviral Transduction Particles
RAB5B, member RAS oncogene family
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177411.4-614s21c1
Sequence:GTACCGGTATGAAGAGGCTCAGGCATATCTCGAGATATGCCTGAGCCTCTTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177411.4-276s21c1
Sequence:GTACCGGGGAAGTCTAGCCTGGTGTTACCTCGAGGTAACACCAGGCTAGACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177411.4-508s21c1
Sequence:CCGGTCGGGCAAAGACATGGGTAAACTCGAGTTTACCCATGTCTTTGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177411.4-675s21c1
Sequence:CCGGAGACTGCTATGAACGTGAATGCTCGAGCATTCACGTTCATAGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177411.4-304s21c1
Sequence:CCGGCAAAGGACAGTTCCATGAATACTCGAGTATTCATGGAACTGTCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177411.4-544s21c1
Sequence:CCGGAGCCAGCCCTAGCATTGTTATCTCGAGATAACAATGCTAGGGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177411.4-1766s21c1
Sequence:CCGGGCACTTTAATTGATGGTAGTTCTCGAGAACTACCATCAATTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100620    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177411.2-1760s1c1
Sequence:CCGGGCACTTTAATTGATGGTAGTTCTCGAGAACTACCATCAATTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177411.2-359s1c1
Sequence:CCGGCCGTGTGTTTAGATGACACAACTCGAGTTGTGTCATCTAAACACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177411.2-631s1c1
Sequence:CCGGGCAGATGACAACAGCTTATTACTCGAGTAATAAGCTGTTGTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177411.2-468s1c1
Sequence:CCGGCGTGGTCTATGATATTACTAACTCGAGTTAGTAATATCATAGACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177411.2-699s1c1
Sequence:CCGGCCTGGCAATAGCAAAGAAGTTCTCGAGAACTTCTTTGCTATTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks