EMAIL THIS PAGE TO A FRIEND

RAB9A

RAB9A, member RAS oncogene family

Synonyms: RAB9
UniProtKB ID: P51151, A8K390, Q6ICN1
Gene ID:
Rat(84589) RAB9A, member RAS oncogene family
cow(511776) RAB9A, member RAS oncogene family
sheep(100302073) RAB9A, member RAS oncogene family
naked mole-rat(101723245) RAB9A, member RAS oncogene family
domestic guinea pig(100717154) RAB9A, member RAS oncogene family
Zebrafish(751756) RAB9A, member RAS oncogene family
domestic cat(101089079) RAB9A, member RAS oncogene family
dog(403947) RAB9A, member RAS oncogene family
chicken(418635) RAB9A, member RAS oncogene family
38 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004251 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004251 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004251 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU014841 MISSION® esiRNA esiRNA targeting human RAB9A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004251 Rosetta Predictions human pricing
NM_053458 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004251 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157941 predicted 726
2 SASI_Hs01_00157942 predicted 387
3 SASI_Hs01_00157943 predicted 787
4 SASI_Hs01_00157944 predicted 607
5 SASI_Hs01_00157945 predicted 701
6 SASI_Hs01_00157946 predicted 809
7 SASI_Hs01_00157947 predicted 546
8 SASI_Hs01_00157948 predicted 735
9 SASI_Hs01_00157950 predicted 508
10 SASI_Hs02_00337192 predicted 656
11 SASI_Hs01_00157949 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053458 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067991 predicted 426
2 SASI_Rn01_00067992 predicted 551
3 SASI_Rn01_00067993 predicted 257
4 SASI_Rn01_00067994 predicted 263
5 SASI_Rn01_00067995 predicted 387
6 SASI_Rn01_00067997 predicted 223
7 SASI_Rn01_00067999 predicted 510
8 SASI_Rn01_00068000 predicted 485
9 SASI_Rn02_00266036 predicted 232
10 SASI_Rn02_00266037 predicted 514
11 SASI_Rn01_00067996 predicted 244
12 SASI_Rn01_00067998 predicted 241
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004251
VALIDATED
RAB9A MISSION shRNA Bacterial Glycerol Stock
RAB9A, member RAS oncogene family
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004251.3-740s1c1
Sequence:CCGGCACAGTCAATCTTCACCGAAACTCGAGTTTCGGTGAAGATTGACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004251.3-467s1c1
Sequence:CCGGCCAGAACTTAAGTAACTGGAACTCGAGTTCCAGTTACTTAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004251.3-287s1c1
Sequence:CCGGGCTCTTCCATACAATAGGTGTCTCGAGACACCTATTGTATGGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004251.3-242s1c1
Sequence:CCGGGAGTTCACTTATGAACAGATACTCGAGTATCTGTTCATAAGTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004251.3-706s1c1
Sequence:CCGGCCGAGGATAGGTCAGATCATTCTCGAGAATGATCTGACCTATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382231    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004251.3-794s21c1
Sequence:GTACCGGAGATTGTTGATGCATTCTAACCTCGAGGTTAGAATGCATCAACAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004251.3-850s21c1
Sequence:GTACCGGGGAGAAGAGAATTAGCGTTTGCTCGAGCAAACGCTAATTCTCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004251.3-675s21c1
Sequence:GTACCGGTTTGAGGAAGCGGTTCGAAGACTCGAGTCTTCGAACCGCTTCCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004251.3-706s21c1
Sequence:CCGGCCGAGGATAGGTCAGATCATTCTCGAGAATGATCTGACCTATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004251.3-874s21c1
Sequence:CCGGCAGTGTATCATCTACTAATAACTCGAGTTATTAGTAGATGATACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004251.3-548s21c1
Sequence:CCGGGGGTAACAAGATTGACATAAGCTCGAGCTTATGTCAATCTTGTTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004251.3-612s21c1
Sequence:CCGGGACAACGGCGACTATCCTTATCTCGAGATAAGGATAGTCGCCGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004251.3-390s21c1
Sequence:CCGGCGAAGCCTGAGGACACCATTTCTCGAGAAATGGTGTCCTCAGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004251.3-443s21c1
Sequence:GTACCGGTAGTGTCGATGATTCACAAAGCTCGAGCTTTGTGAATCATCGACACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004251.3-741s21c1
Sequence:GTACCGGACAGTCAATCTTCACCGAAAGCTCGAGCTTTCGGTGAAGATTGACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004251
VALIDATED
RAB9A MISSION shRNA shRNA Plasmid DNA
RAB9A, member RAS oncogene family
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004251.3-740s1c1
Sequence:CCGGCACAGTCAATCTTCACCGAAACTCGAGTTTCGGTGAAGATTGACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004251.3-467s1c1
Sequence:CCGGCCAGAACTTAAGTAACTGGAACTCGAGTTCCAGTTACTTAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004251.3-287s1c1
Sequence:CCGGGCTCTTCCATACAATAGGTGTCTCGAGACACCTATTGTATGGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004251.3-242s1c1
Sequence:CCGGGAGTTCACTTATGAACAGATACTCGAGTATCTGTTCATAAGTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004251.3-706s1c1
Sequence:CCGGCCGAGGATAGGTCAGATCATTCTCGAGAATGATCTGACCTATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382231    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004251.3-794s21c1
Sequence:GTACCGGAGATTGTTGATGCATTCTAACCTCGAGGTTAGAATGCATCAACAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004251.3-850s21c1
Sequence:GTACCGGGGAGAAGAGAATTAGCGTTTGCTCGAGCAAACGCTAATTCTCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004251.3-675s21c1
Sequence:GTACCGGTTTGAGGAAGCGGTTCGAAGACTCGAGTCTTCGAACCGCTTCCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004251.3-706s21c1
Sequence:CCGGCCGAGGATAGGTCAGATCATTCTCGAGAATGATCTGACCTATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004251.3-874s21c1
Sequence:CCGGCAGTGTATCATCTACTAATAACTCGAGTTATTAGTAGATGATACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004251.3-548s21c1
Sequence:CCGGGGGTAACAAGATTGACATAAGCTCGAGCTTATGTCAATCTTGTTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004251.3-612s21c1
Sequence:CCGGGACAACGGCGACTATCCTTATCTCGAGATAAGGATAGTCGCCGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004251.3-390s21c1
Sequence:CCGGCGAAGCCTGAGGACACCATTTCTCGAGAAATGGTGTCCTCAGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004251.3-443s21c1
Sequence:GTACCGGTAGTGTCGATGATTCACAAAGCTCGAGCTTTGTGAATCATCGACACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004251.3-741s21c1
Sequence:GTACCGGACAGTCAATCTTCACCGAAAGCTCGAGCTTTCGGTGAAGATTGACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004251
VALIDATED
RAB9A MISSION shRNA Lentiviral Transduction Particles
RAB9A, member RAS oncogene family
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004251.3-740s1c1
Sequence:CCGGCACAGTCAATCTTCACCGAAACTCGAGTTTCGGTGAAGATTGACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004251.3-467s1c1
Sequence:CCGGCCAGAACTTAAGTAACTGGAACTCGAGTTCCAGTTACTTAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004251.3-287s1c1
Sequence:CCGGGCTCTTCCATACAATAGGTGTCTCGAGACACCTATTGTATGGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004251.3-242s1c1
Sequence:CCGGGAGTTCACTTATGAACAGATACTCGAGTATCTGTTCATAAGTGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004251.3-706s1c1
Sequence:CCGGCCGAGGATAGGTCAGATCATTCTCGAGAATGATCTGACCTATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382231    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004251.3-794s21c1
Sequence:GTACCGGAGATTGTTGATGCATTCTAACCTCGAGGTTAGAATGCATCAACAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004251.3-850s21c1
Sequence:GTACCGGGGAGAAGAGAATTAGCGTTTGCTCGAGCAAACGCTAATTCTCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004251.3-675s21c1
Sequence:GTACCGGTTTGAGGAAGCGGTTCGAAGACTCGAGTCTTCGAACCGCTTCCTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004251.3-706s21c1
Sequence:CCGGCCGAGGATAGGTCAGATCATTCTCGAGAATGATCTGACCTATCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004251.3-874s21c1
Sequence:CCGGCAGTGTATCATCTACTAATAACTCGAGTTATTAGTAGATGATACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004251.3-548s21c1
Sequence:CCGGGGGTAACAAGATTGACATAAGCTCGAGCTTATGTCAATCTTGTTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004251.3-612s21c1
Sequence:CCGGGACAACGGCGACTATCCTTATCTCGAGATAAGGATAGTCGCCGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004251.3-390s21c1
Sequence:CCGGCGAAGCCTGAGGACACCATTTCTCGAGAAATGGTGTCCTCAGGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004251.3-443s21c1
Sequence:GTACCGGTAGTGTCGATGATTCACAAAGCTCGAGCTTTGTGAATCATCGACACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004251.3-741s21c1
Sequence:GTACCGGACAGTCAATCTTCACCGAAAGCTCGAGCTTTCGGTGAAGATTGACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks