EMAIL THIS PAGE TO A FRIEND

RAC1

ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)

Synonyms: Rac-1 TC-25 p21-Rac1
UniProtKB ID: P63000, O95501, P15154, Q3Y4D3, Q5JAA8, Q9BTB4
Gene ID:
Human(5879) Summary: The protein encoded by this gene is a GTPase which belongs to the RAS superfamily of small GTP-binding proteins. Members of this superfamily appear to regulate a diverse array of cellular events, including the control of cell growth, cytoskeletal reorganization, and the activation of protein kinases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Mouse(19353) RAS-related C3 botulinum substrate 1
Rat(363875) ras-related C3 botulinum toxin substrate 1
fruit fly(38146) CG2248 gene product from transcript CG2248-RB
Zebrafish(327204) ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)
domestic cat(101101277) ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)
dog(403955) ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)
chicken(395871) ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)
cow(281440) ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)
sheep(100101233) ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)
naked mole-rat(101706434) ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)
Domestic Rabbit(100008953) ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)
domestic guinea pig(100727219) ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)
Gene Class: Cytoskeleton
166 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009007 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009007 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009007 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006908 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006908 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006908 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
09-890 Anti-pan-AMPylated Threonine Antibody 100 µL, Anti-pan-AMPylated Threonine Antibody is an antibody against AMPylated Threonine for use in WB & IP. pricing
07-896-I Anti-phospho-Rac1/cdc42 (Ser71) Antibody 100 µL, Detect Rac1/CDC42 using this rabbit Polyclonal Anti-phospho-Rac1/cdc42 (Ser71) Antibody, Cat. No. 07-896-I, validated for use in Western Blotting, Immunoprecipitation. pricing
07-1464 Anti-Rac1 Antibody 100 µg, Anti-Rac1 Antibody is an antibody against Rac1 for use in WB. pricing
05-389 Anti-Rac1 Antibody, clone 23A8 250 µg, This Anti-Rac1 Antibody, clone 23A8 has been published in more than 40 citations and validated for use in Immunohistochemistry (IHC), Immunoprecipitation (IP) and Western Blotting (WB) for the detection of Rac1 protein. pricing
05-389-AF488 Anti-Rac1 Antibody, clone 23A8, Alexa Fluor® 488 Conjugate 100 µL, This Anti-Rac1 Antibody, clone 23A8, Alexa Fluor® 488 Conjugate is validated for use in Immunocytochemistry for the detection of Rac1. pricing
05-389-AF647 Anti-Rac1 Antibody, clone 23A8, Alexa Fluor® 647 Conjugate 100 µL, Anti-Rac1 Antibody, clone 23A8, Alexa Fluor® 647 Conjugate is an antibody against Rac1 for use in Immunocytochemistry. pricing
16-319 Anti-Rac1 Antibody, clone 23A8, Magnetic bead Conjugate 400 µL, Anti-Rac1 Antibody, clone 23A8, Magnetic bead Conjugate detects level of Rac1 & has been published & validated for use in WB & IP. pricing
09-271 Anti-Rac1b Antibody 100 µL, Detect Rac1b using this Anti-Rac1b Antibody validated for use in WB, IH(P) & IF. pricing
FCMAB330F Milli-Mark™ Anti-Rac1-FITC Antibody, clone 23A8 100 tests, Milli-Mark Anti-Rac1-FITC Antibody, clone 23A8 detects level of Rac1 & has been published & validated for use in FC. pricing
17-283 Rac1 Activation Assay Kit 1 kit, Non-radioactive Rac1 Activation Assay Kit can be used to precipitate Rac1-GTP from cell lysates & detection by a Rac1 specific monoclonal antibody. pricing
17-10393 Rac1 Activation Magnetic Beads Pulldown Assay 30 assays, Non-radioactive Rac1 Activation Assay Kit can be used to precipitate Rac1-GTP from cell lysates, & detection by a Rac1 specific monoclonal antibody. pricing
17-441 Rac1/Cdc42 Activation Assay Kit 30 assays, The Rac1/Cdc42 Activation Assay provides an effective method for detecting Rac & Cdc42 activity in cell lysates. pricing
17-10394 Rac1/cdc42 Activation Magnetic Beads Pulldown Assay 30 assays, The Rac1/cdc42 Activation Magnetic Beads Pulldown Assay provides an effective method for detecting Rac & Cdc42 activity in cell lysates with higher yield & easier process utilizing magenetic bead properties. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006908 Rosetta Predictions human pricing
NM_018890 Rosetta Predictions human pricing
NM_198829 Rosetta Predictions human pricing
NM_134366 Rosetta Predictions rat pricing
NM_009007 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006908 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015565 predicted 457
2 SASI_Hs01_00015566 predicted 1019
3 SASI_Hs02_00342586 predicted 1290
4 SASI_Hs01_00015568 predicted 293
5 SASI_Hs01_00015569 predicted 564
6 SASI_Hs01_00015570 predicted 485
7 SASI_Hs01_00015571 predicted 1255
8 SASI_Hs01_00015572 predicted 1191
9 SASI_Hs01_00015573 predicted 1235
10 SASI_Hs01_00015574 predicted 1246
11 SASI_Hs01_00015567 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018890 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164504 predicted 1079
2 SASI_Hs01_00164506 predicted 464
3 SASI_Hs02_00352316 predicted 1347
4 SASI_Hs01_00164507 predicted 295
5 SASI_Hs01_00164508 predicted 622
6 SASI_Hs01_00164509 predicted 546
7 SASI_Hs01_00164510 predicted 1310
8 SASI_Hs01_00164511 predicted 1244
9 SASI_Hs01_00164512 predicted 1290
10 SASI_Hs01_00164513 predicted 1303
11 SASI_Hs01_00164505 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198829 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220577 predicted 515
2 SASI_Hs01_00220578 predicted 1073
3 SASI_Hs01_00220579 predicted 1345
4 SASI_Hs01_00220580 predicted 625
5 SASI_Hs01_00220582 predicted 541
6 SASI_Hs01_00220583 predicted 1315
7 SASI_Hs02_00372332 predicted 459
8 SASI_Hs01_00220584 predicted 1243
9 SASI_Hs01_00220585 predicted 1292
10 SASI_Hs01_00220586 predicted 1301
11 SASI_Hs01_00220581 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134366 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118554 predicted 316
2 SASI_Rn01_00118555 predicted 281
3 SASI_Rn02_00267929 predicted 212
4 SASI_Rn02_00267930 predicted 419
5 SASI_Rn01_00118556 predicted 291
6 SASI_Rn01_00118557 predicted 489
7 SASI_Rn01_00118558 predicted 249
8 SASI_Rn01_00118559 predicted 342
9 SASI_Rn01_00118560 predicted 495
10 SASI_Rn01_00118562 predicted 337
11 SASI_Rn01_00118561 predicted 345
12 SASI_Rn01_00118563 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009007 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156173 predicted 1076
2 SASI_Mm01_00156174 predicted 468
3 SASI_Mm01_00156178 predicted 1195
4 SASI_Mm01_00156171 predicted 990
5 SASI_Mm01_00156172 predicted 950
6 SASI_Mm01_00156175 predicted 482
7 SASI_Mm01_00156176 predicted 686
8 SASI_Mm01_00156177 predicted 436
9 SASI_Mm01_00156179 predicted 538
10 SASI_Mm02_00315139 predicted 889
11 SASI_Mm01_00156180 predicted 906
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009007
VALIDATED
RAC1 MISSION shRNA Bacterial Glycerol Stock
ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009007.1-545s1c1
Sequence:CCGGGCTTGATCTTAGGGATGATAACTCGAGTTATCATCCCTAAGATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009007.1-415s1c1
Sequence:CCGGCGCAGACAGACGTGTTCTTAACTCGAGTTAAGAACACGTCTGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009007.1-322s1c1
Sequence:CCGGCCAATGTTATGGTAGATGGAACTCGAGTTCCATCTACCATAACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009007.1-255s1c1
Sequence:CCGGCTCATCAGTTACACGACCAATCTCGAGATTGGTCGTGTAACTGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009007.1-684s1c1
Sequence:CCGGCGAGGACTCAAGACAGTGTTTCTCGAGAAACACTGTCTTGAGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009007.2-544s21c1
Sequence:CCGGGCTTGATCTTAGGGATGATAACTCGAGTTATCATCCCTAAGATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009007.2-414s21c1
Sequence:CCGGCGCAGACAGACGTGTTCTTAACTCGAGTTAAGAACACGTCTGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310901    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009007.2-833s21c1
Sequence:CCGGATCAGCGAGCCTTCGCATTTGCTCGAGCAAATGCGAAGGCTCGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009007.2-471s21c1
Sequence:CCGGATGTCCGTGCAAAGTGGTATCCTCGAGGATACCACTTTGCACGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009007.2-224s21c1
Sequence:CCGGGGAGACGGAGCTGTTGGTAAACTCGAGTTTACCAACAGCTCCGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009007
VALIDATED
RAC1 MISSION shRNA shRNA Plasmid DNA
ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009007.1-545s1c1
Sequence:CCGGGCTTGATCTTAGGGATGATAACTCGAGTTATCATCCCTAAGATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009007.1-415s1c1
Sequence:CCGGCGCAGACAGACGTGTTCTTAACTCGAGTTAAGAACACGTCTGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009007.1-322s1c1
Sequence:CCGGCCAATGTTATGGTAGATGGAACTCGAGTTCCATCTACCATAACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009007.1-255s1c1
Sequence:CCGGCTCATCAGTTACACGACCAATCTCGAGATTGGTCGTGTAACTGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009007.1-684s1c1
Sequence:CCGGCGAGGACTCAAGACAGTGTTTCTCGAGAAACACTGTCTTGAGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009007.2-544s21c1
Sequence:CCGGGCTTGATCTTAGGGATGATAACTCGAGTTATCATCCCTAAGATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009007.2-414s21c1
Sequence:CCGGCGCAGACAGACGTGTTCTTAACTCGAGTTAAGAACACGTCTGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310901    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009007.2-833s21c1
Sequence:CCGGATCAGCGAGCCTTCGCATTTGCTCGAGCAAATGCGAAGGCTCGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009007.2-471s21c1
Sequence:CCGGATGTCCGTGCAAAGTGGTATCCTCGAGGATACCACTTTGCACGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009007.2-224s21c1
Sequence:CCGGGGAGACGGAGCTGTTGGTAAACTCGAGTTTACCAACAGCTCCGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009007
VALIDATED
RAC1 MISSION shRNA Lentiviral Transduction Particles
ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009007.1-545s1c1
Sequence:CCGGGCTTGATCTTAGGGATGATAACTCGAGTTATCATCCCTAAGATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009007.1-415s1c1
Sequence:CCGGCGCAGACAGACGTGTTCTTAACTCGAGTTAAGAACACGTCTGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009007.1-322s1c1
Sequence:CCGGCCAATGTTATGGTAGATGGAACTCGAGTTCCATCTACCATAACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009007.1-255s1c1
Sequence:CCGGCTCATCAGTTACACGACCAATCTCGAGATTGGTCGTGTAACTGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009007.1-684s1c1
Sequence:CCGGCGAGGACTCAAGACAGTGTTTCTCGAGAAACACTGTCTTGAGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009007.2-544s21c1
Sequence:CCGGGCTTGATCTTAGGGATGATAACTCGAGTTATCATCCCTAAGATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009007.2-414s21c1
Sequence:CCGGCGCAGACAGACGTGTTCTTAACTCGAGTTAAGAACACGTCTGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310901    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009007.2-833s21c1
Sequence:CCGGATCAGCGAGCCTTCGCATTTGCTCGAGCAAATGCGAAGGCTCGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009007.2-471s21c1
Sequence:CCGGATGTCCGTGCAAAGTGGTATCCTCGAGGATACCACTTTGCACGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009007.2-224s21c1
Sequence:CCGGGGAGACGGAGCTGTTGGTAAACTCGAGTTTACCAACAGCTCCGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006908
VALIDATED
RAC1 MISSION shRNA Bacterial Glycerol Stock
ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006908.3-2007s1c1
Sequence:CCGGCCTTCTTAACATCACTGTCTTCTCGAGAAGACAGTGATGTTAAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006908.3-784s1c1
Sequence:CCGGCGTGAAGAAGAGGAAGAGAAACTCGAGTTTCTCTTCCTCTTCTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006908.3-340s1c1
Sequence:CCGGCCCTACTGTCTTTGACAATTACTCGAGTAATTGTCAAAGACAGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_006908.3-459s1c1
Sequence:CCGGCGCAAACAGATGTGTTCTTAACTCGAGTTAAGAACACATCTGTTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006908.3-677s1c1
Sequence:CCGGGCTAAGGAGATTGGTGCTGTACTCGAGTACAGCACCAATCTCCTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006908.4-677s21c1
Sequence:CCGGGCTAAGGAGATTGGTGCTGTACTCGAGTACAGCACCAATCTCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318432    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_006908.4-2007s21c1
Sequence:CCGGCCTTCTTAACATCACTGTCTTCTCGAGAAGACAGTGATGTTAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006908.4-340s21c1
Sequence:CCGGCCCTACTGTCTTTGACAATTACTCGAGTAATTGTCAAAGACAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006908.4-784s21c1
Sequence:CCGGCGTGAAGAAGAGGAAGAGAAACTCGAGTTTCTCTTCCTCTTCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006908
VALIDATED
RAC1 MISSION shRNA shRNA Plasmid DNA
ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006908.3-2007s1c1
Sequence:CCGGCCTTCTTAACATCACTGTCTTCTCGAGAAGACAGTGATGTTAAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006908.3-784s1c1
Sequence:CCGGCGTGAAGAAGAGGAAGAGAAACTCGAGTTTCTCTTCCTCTTCTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006908.3-340s1c1
Sequence:CCGGCCCTACTGTCTTTGACAATTACTCGAGTAATTGTCAAAGACAGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_006908.3-459s1c1
Sequence:CCGGCGCAAACAGATGTGTTCTTAACTCGAGTTAAGAACACATCTGTTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006908.3-677s1c1
Sequence:CCGGGCTAAGGAGATTGGTGCTGTACTCGAGTACAGCACCAATCTCCTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006908.4-677s21c1
Sequence:CCGGGCTAAGGAGATTGGTGCTGTACTCGAGTACAGCACCAATCTCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318432    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_006908.4-2007s21c1
Sequence:CCGGCCTTCTTAACATCACTGTCTTCTCGAGAAGACAGTGATGTTAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006908.4-340s21c1
Sequence:CCGGCCCTACTGTCTTTGACAATTACTCGAGTAATTGTCAAAGACAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006908.4-784s21c1
Sequence:CCGGCGTGAAGAAGAGGAAGAGAAACTCGAGTTTCTCTTCCTCTTCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006908
VALIDATED
RAC1 MISSION shRNA Lentiviral Transduction Particles
ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006908.3-2007s1c1
Sequence:CCGGCCTTCTTAACATCACTGTCTTCTCGAGAAGACAGTGATGTTAAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006908.3-784s1c1
Sequence:CCGGCGTGAAGAAGAGGAAGAGAAACTCGAGTTTCTCTTCCTCTTCTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006908.3-340s1c1
Sequence:CCGGCCCTACTGTCTTTGACAATTACTCGAGTAATTGTCAAAGACAGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_006908.3-459s1c1
Sequence:CCGGCGCAAACAGATGTGTTCTTAACTCGAGTTAAGAACACATCTGTTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006908.3-677s1c1
Sequence:CCGGGCTAAGGAGATTGGTGCTGTACTCGAGTACAGCACCAATCTCCTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006908.4-677s21c1
Sequence:CCGGGCTAAGGAGATTGGTGCTGTACTCGAGTACAGCACCAATCTCCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318432    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_006908.4-2007s21c1
Sequence:CCGGCCTTCTTAACATCACTGTCTTCTCGAGAAGACAGTGATGTTAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006908.4-340s21c1
Sequence:CCGGCCCTACTGTCTTTGACAATTACTCGAGTAATTGTCAAAGACAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006908.4-784s21c1
Sequence:CCGGCGTGAAGAAGAGGAAGAGAAACTCGAGTTTCTCTTCCTCTTCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks