EMAIL THIS PAGE TO A FRIEND

RAI2

retinoic acid induced 2

UniProtKB ID: Q9Y5P3, B1B1K2, B4DQM9, E7EMN4, Q8N6X7
Gene ID:
Human(10742) Summary: Retinoic acid plays a critical role in development, cellular growth, and differentiation. The specific function of this retinoic acid-induced gene has not yet been determined but it may play a role in development. The chromosomal location of this gene designates it to be a candidate for diseases such as Nance-Horan syndrome, sensorineural deafness, non-specific X-linked mental retardation, oral-facial-digital syndrome, and Fried syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
Mouse(24004) retinoic acid induced 2
Rat(501555) retinoic acid induced 2
cow(539414) retinoic acid induced 2
sheep(101107764) retinoic acid induced 2
naked mole-rat(101710912) retinoic acid induced 2
domestic guinea pig(100733488) retinoic acid induced 2
chicken(418614) retinoic acid induced 2
dog(100685169) retinoic acid induced 2
Horse(100051458) retinoic acid induced 2
domestic cat(101099182) retinoic acid induced 2
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198409 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198409 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198409 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021785 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021785 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021785 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021785 Rosetta Predictions human pricing
NM_001109316 Rosetta Predictions rat pricing
NM_001103367 Rosetta Predictions mouse pricing
NM_198409 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021785 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355094 predicted 1504
2 SASI_Hs01_00035526 predicted 393
3 SASI_Hs01_00035527 predicted 569
4 SASI_Hs01_00035528 predicted 1804
5 SASI_Hs01_00035529 predicted 1555
6 SASI_Hs01_00035530 predicted 816
7 SASI_Hs01_00035531 predicted 1712
8 SASI_Hs01_00035532 predicted 395
9 SASI_Hs01_00035533 predicted 490
10 SASI_Hs01_00035534 predicted 923
11 SASI_Hs01_00035535 predicted 696
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109316 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247224 predicted 1066
2 SASI_Rn02_00247225 predicted 649
3 SASI_Rn02_00247226 predicted 1621
4 SASI_Rn02_00247227 predicted 529
5 SASI_Rn02_00247228 predicted 473
6 SASI_Rn02_00247229 predicted 1281
7 SASI_Rn02_00247230 predicted 334
8 SASI_Rn02_00247231 predicted 1447
9 SASI_Rn02_00247232 predicted 1390
10 SASI_Rn02_00247233 predicted 1029
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103367 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00303247 predicted 508
2 SASI_Mm02_00303248 predicted 1283
3 SASI_Mm02_00303249 predicted 1321
4 SASI_Mm02_00303250 predicted 1560
5 SASI_Mm02_00303251 predicted 1440
6 SASI_Mm02_00303252 predicted 1475
7 SASI_Mm02_00303253 predicted 1120
8 SASI_Mm02_00303254 predicted 934
9 SASI_Mm02_00303255 predicted 615
10 SASI_Mm02_00303256 predicted 1118
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198409 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350947 predicted 588
2 SASI_Mm01_00163829 predicted 1370
3 SASI_Mm01_00163830 predicted 1397
4 SASI_Mm01_00163831 predicted 1638
5 SASI_Mm02_00350948 predicted 1510
6 SASI_Mm01_00163834 predicted 1546
7 SASI_Mm01_00163835 predicted 1193
8 SASI_Mm02_00350949 predicted 1008
9 SASI_Mm02_00350950 predicted 694
10 SASI_Mm02_00350951 predicted 1199
11 SASI_Mm01_00163827 predicted 698
12 SASI_Mm01_00163828 predicted 280
13 SASI_Mm01_00163832 predicted 381
14 SASI_Mm01_00163833 predicted 381
15 SASI_Mm01_00163836 predicted 1423
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198409
RAI2 MISSION shRNA Bacterial Glycerol Stock
retinoic acid induced 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200452    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198409.1-1964s1c1
Sequence:CCGGGTGGGAGCAGAAAGGCAAATTCTCGAGAATTTGCCTTTCTGCTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198409.3-887s1c1
Sequence:CCGGGAAGCTGTGCTCCAGAATTTACTCGAGTAAATTCTGGAGCACAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198409.3-2052s21c1
Sequence:CCGGGCAAATTAGCTAGTATCATTTCTCGAGAAATGATACTAGCTAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198409.3-382s21c1
Sequence:CCGGCCCTCCCACTTTGGCTAATAACTCGAGTTATTAGCCAAAGTGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198409.3-1213s21c1
Sequence:CCGGCCTCCAGTCAAAGGAGTATTTCTCGAGAAATACTCCTTTGACTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198409.3-1143s21c1
Sequence:CCGGCCTTCGGCTTGCACTCCTTTACTCGAGTAAAGGAGTGCAAGCCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198409.3-656s21c1
Sequence:CCGGGGCAACGCTACCTACGTTATGCTCGAGCATAACGTAGGTAGCGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198409
RAI2 MISSION shRNA shRNA Plasmid DNA
retinoic acid induced 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200452    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198409.1-1964s1c1
Sequence:CCGGGTGGGAGCAGAAAGGCAAATTCTCGAGAATTTGCCTTTCTGCTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198409.3-887s1c1
Sequence:CCGGGAAGCTGTGCTCCAGAATTTACTCGAGTAAATTCTGGAGCACAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198409.3-2052s21c1
Sequence:CCGGGCAAATTAGCTAGTATCATTTCTCGAGAAATGATACTAGCTAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198409.3-382s21c1
Sequence:CCGGCCCTCCCACTTTGGCTAATAACTCGAGTTATTAGCCAAAGTGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198409.3-1213s21c1
Sequence:CCGGCCTCCAGTCAAAGGAGTATTTCTCGAGAAATACTCCTTTGACTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198409.3-1143s21c1
Sequence:CCGGCCTTCGGCTTGCACTCCTTTACTCGAGTAAAGGAGTGCAAGCCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198409.3-656s21c1
Sequence:CCGGGGCAACGCTACCTACGTTATGCTCGAGCATAACGTAGGTAGCGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198409
RAI2 MISSION shRNA Lentiviral Transduction Particles
retinoic acid induced 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200452    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198409.1-1964s1c1
Sequence:CCGGGTGGGAGCAGAAAGGCAAATTCTCGAGAATTTGCCTTTCTGCTCCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217313    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198409.3-887s1c1
Sequence:CCGGGAAGCTGTGCTCCAGAATTTACTCGAGTAAATTCTGGAGCACAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246649    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198409.3-2052s21c1
Sequence:CCGGGCAAATTAGCTAGTATCATTTCTCGAGAAATGATACTAGCTAATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198409.3-382s21c1
Sequence:CCGGCCCTCCCACTTTGGCTAATAACTCGAGTTATTAGCCAAAGTGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198409.3-1213s21c1
Sequence:CCGGCCTCCAGTCAAAGGAGTATTTCTCGAGAAATACTCCTTTGACTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198409.3-1143s21c1
Sequence:CCGGCCTTCGGCTTGCACTCCTTTACTCGAGTAAAGGAGTGCAAGCCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198409.3-656s21c1
Sequence:CCGGGGCAACGCTACCTACGTTATGCTCGAGCATAACGTAGGTAGCGTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021785
RAI2 MISSION shRNA Bacterial Glycerol Stock
retinoic acid induced 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021785.2-1565s1c1
Sequence:CCGGCCATGATGGATAGTCACATCACTCGAGTGATGTGACTATCCATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021785.2-1447s1c1
Sequence:CCGGCCTGAGACACTGTATGACAGTCTCGAGACTGTCATACAGTGTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021785.2-685s1c1
Sequence:CCGGGAGCTCAATCCGAATGGCAATCTCGAGATTGCCATTCGGATTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121887    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021785.2-2162s1c1
Sequence:CCGGGAGTAAATAAGAGCAACCTATCTCGAGATAGGTTGCTCTTATTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021785.2-439s1c1
Sequence:CCGGGCTAATAACAGACTGGAGAATCTCGAGATTCTCCAGTCTGTTATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021785.2-1725s1c1
Sequence:CCGGCATATTCTGTGGCAAGATCAACTCGAGTTGATCTTGCCACAGAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021785.2-1878s1c1
Sequence:CCGGCCGGAGCATAAAGTTAAAGAACTCGAGTTCTTTAACTTTATGCTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021785.4-982s21c1
Sequence:CCGGTTGCCTGTGCCAGTCCCTATTCTCGAGAATAGGGACTGGCACAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021785.4-2093s21c1
Sequence:CCGGTGCAGCTTTAATGGAATATTGCTCGAGCAATATTCCATTAAAGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021785
RAI2 MISSION shRNA shRNA Plasmid DNA
retinoic acid induced 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021785.2-1565s1c1
Sequence:CCGGCCATGATGGATAGTCACATCACTCGAGTGATGTGACTATCCATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021785.2-1447s1c1
Sequence:CCGGCCTGAGACACTGTATGACAGTCTCGAGACTGTCATACAGTGTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021785.2-685s1c1
Sequence:CCGGGAGCTCAATCCGAATGGCAATCTCGAGATTGCCATTCGGATTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121887    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021785.2-2162s1c1
Sequence:CCGGGAGTAAATAAGAGCAACCTATCTCGAGATAGGTTGCTCTTATTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021785.2-439s1c1
Sequence:CCGGGCTAATAACAGACTGGAGAATCTCGAGATTCTCCAGTCTGTTATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021785.2-1725s1c1
Sequence:CCGGCATATTCTGTGGCAAGATCAACTCGAGTTGATCTTGCCACAGAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021785.2-1878s1c1
Sequence:CCGGCCGGAGCATAAAGTTAAAGAACTCGAGTTCTTTAACTTTATGCTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021785.4-982s21c1
Sequence:CCGGTTGCCTGTGCCAGTCCCTATTCTCGAGAATAGGGACTGGCACAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021785.4-2093s21c1
Sequence:CCGGTGCAGCTTTAATGGAATATTGCTCGAGCAATATTCCATTAAAGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021785
RAI2 MISSION shRNA Lentiviral Transduction Particles
retinoic acid induced 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021785.2-1565s1c1
Sequence:CCGGCCATGATGGATAGTCACATCACTCGAGTGATGTGACTATCCATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021785.2-1447s1c1
Sequence:CCGGCCTGAGACACTGTATGACAGTCTCGAGACTGTCATACAGTGTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021785.2-685s1c1
Sequence:CCGGGAGCTCAATCCGAATGGCAATCTCGAGATTGCCATTCGGATTGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121887    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021785.2-2162s1c1
Sequence:CCGGGAGTAAATAAGAGCAACCTATCTCGAGATAGGTTGCTCTTATTTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021785.2-439s1c1
Sequence:CCGGGCTAATAACAGACTGGAGAATCTCGAGATTCTCCAGTCTGTTATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021785.2-1725s1c1
Sequence:CCGGCATATTCTGTGGCAAGATCAACTCGAGTTGATCTTGCCACAGAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021785.2-1878s1c1
Sequence:CCGGCCGGAGCATAAAGTTAAAGAACTCGAGTTCTTTAACTTTATGCTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021785.4-982s21c1
Sequence:CCGGTTGCCTGTGCCAGTCCCTATTCTCGAGAATAGGGACTGGCACAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021785.4-2093s21c1
Sequence:CCGGTGCAGCTTTAATGGAATATTGCTCGAGCAATATTCCATTAAAGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks