EMAIL THIS PAGE TO A FRIEND

RALBP1

ralA binding protein 1

Synonyms: RIP1 RLIP1 RLIP76
UniProtKB ID: Q15311, D3DUI0
Gene ID:
Human(10928) Summary: RALBP1 plays a role in receptor-mediated endocytosis and is a downstream effector of the small GTP-binding protein RAL (see RALA; MIM 179550). Small G proteins, such as RAL, have GDP-bound inactive and GTP-bound active forms, which shift from the inactive to the active state through the action of RALGDS (MIM 601619), which in turn is activated by RAS (see HRAS; MIM 190020) (summary by Feig, 2003 [PubMed 12888294]
Mouse(19765) ralA binding protein 1
Rat(84014) ralA binding protein 1
Zebrafish(404612) ralA binding protein 1
chicken(429466) ralA binding protein 1
Horse(100049994) ralA binding protein 1
domestic cat(101082017) ralA binding protein 1
dog(490548) ralA binding protein 1
domestic guinea pig(100713172) ralA binding protein 1
naked mole-rat(101711056) ralA binding protein 1
Domestic Rabbit(100356708) ralA binding protein 1
cow(523324) ralA binding protein 1
Goat(100861013) ralA binding protein 1
sheep(101107653) ralA binding protein 1
Gene Class: ATPase
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009067 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009067 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009067 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006788 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006788 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006788 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006788 Rosetta Predictions human pricing
NM_032067 Rosetta Predictions rat pricing
NM_009067 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006788 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136774 predicted 1465
2 SASI_Hs01_00136775 predicted 1566
3 SASI_Hs01_00136776 predicted 1583
4 SASI_Hs01_00136778 predicted 1581
5 SASI_Hs01_00136779 predicted 1557
6 SASI_Hs02_00342307 predicted 1867
7 SASI_Hs01_00136780 predicted 1319
8 SASI_Hs01_00136781 predicted 947
9 SASI_Hs01_00136782 predicted 1469
10 SASI_Hs01_00136783 predicted 1058
11 SASI_Hs01_00136777 predicted 1774
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032067 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057370 predicted 1831
2 SASI_Rn01_00057371 predicted 2071
3 SASI_Rn01_00057372 predicted 1518
4 SASI_Rn01_00057373 predicted 1367
5 SASI_Rn01_00057374 predicted 1806
6 SASI_Rn01_00057375 predicted 1797
7 SASI_Rn01_00057376 predicted 940
8 SASI_Rn01_00057377 predicted 1458
9 SASI_Rn02_00265425 predicted 1787
10 SASI_Rn02_00265426 predicted 1623
11 SASI_Rn01_00057378 predicted 1671
12 SASI_Rn01_00057379 predicted 1621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009067 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315237 predicted 813
2 SASI_Mm01_00153449 predicted 1407
3 SASI_Mm01_00153450 predicted 1397
4 SASI_Mm01_00153451 predicted 1312
5 SASI_Mm02_00315238 predicted 1422
6 SASI_Mm02_00315239 predicted 1750
7 SASI_Mm02_00315240 predicted 1497
8 SASI_Mm02_00315241 predicted 1316
9 SASI_Mm01_00153454 predicted 1408
10 SASI_Mm02_00315242 predicted 1565
11 SASI_Mm01_00153448 predicted 1578
12 SASI_Mm01_00153452 predicted 1454
13 SASI_Mm01_00153453 predicted 1526
14 SASI_Mm01_00153455 predicted 1575
15 SASI_Mm01_00153456 predicted 976
16 SASI_Mm01_00153457 predicted 1505
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009067
VALIDATED
RALBP1 MISSION shRNA Bacterial Glycerol Stock
ralA binding protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009067.4-225s21c1
Sequence:CCGGCCTCCTGATACAGTGTCAGATCTCGAGATCTGACACTGTATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009067.4-2189s21c1
Sequence:CCGGCAGATAGTGTCAGCTTATTTGCTCGAGCAAATAAGCTGACACTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009067.4-848s21c1
Sequence:CCGGCAGCTTGCTGAAGCAGTATTTCTCGAGAAATACTGCTTCAGCAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009067.4-1424s21c1
Sequence:CCGGACAGGAGATAGCTAGTCTTTCCTCGAGGAAAGACTAGCTATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009067.4-809s21c1
Sequence:CCGGGTCTCCAAACTTAGAAGAATACTCGAGTATTCTTCTAAGTTTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009067.1-3232s1c1
Sequence:CCGGCCTCCCTAGTTAGTATTTATTCTCGAGAATAAATACTAACTAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009067.1-1455s1c1
Sequence:CCGGGCGGGATAAAGGACTTATCTACTCGAGTAGATAAGTCCTTTATCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009067.1-955s1c1
Sequence:CCGGGTCTCCAAACTTAGAAGAATACTCGAGTATTCTTCTAAGTTTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009067.1-371s1c1
Sequence:CCGGCCTCCTGATACAGTGTCAGATCTCGAGATCTGACACTGTATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009067.1-1753s1c1
Sequence:CCGGCCGAGCTGAAATTGCGGAGATCTCGAGATCTCCGCAATTTCAGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009067
VALIDATED
RALBP1 MISSION shRNA shRNA Plasmid DNA
ralA binding protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009067.4-225s21c1
Sequence:CCGGCCTCCTGATACAGTGTCAGATCTCGAGATCTGACACTGTATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009067.4-2189s21c1
Sequence:CCGGCAGATAGTGTCAGCTTATTTGCTCGAGCAAATAAGCTGACACTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009067.4-848s21c1
Sequence:CCGGCAGCTTGCTGAAGCAGTATTTCTCGAGAAATACTGCTTCAGCAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009067.4-1424s21c1
Sequence:CCGGACAGGAGATAGCTAGTCTTTCCTCGAGGAAAGACTAGCTATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009067.4-809s21c1
Sequence:CCGGGTCTCCAAACTTAGAAGAATACTCGAGTATTCTTCTAAGTTTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009067.1-3232s1c1
Sequence:CCGGCCTCCCTAGTTAGTATTTATTCTCGAGAATAAATACTAACTAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009067.1-1455s1c1
Sequence:CCGGGCGGGATAAAGGACTTATCTACTCGAGTAGATAAGTCCTTTATCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009067.1-955s1c1
Sequence:CCGGGTCTCCAAACTTAGAAGAATACTCGAGTATTCTTCTAAGTTTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009067.1-371s1c1
Sequence:CCGGCCTCCTGATACAGTGTCAGATCTCGAGATCTGACACTGTATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009067.1-1753s1c1
Sequence:CCGGCCGAGCTGAAATTGCGGAGATCTCGAGATCTCCGCAATTTCAGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009067
VALIDATED
RALBP1 MISSION shRNA Lentiviral Transduction Particles
ralA binding protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009067.4-225s21c1
Sequence:CCGGCCTCCTGATACAGTGTCAGATCTCGAGATCTGACACTGTATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009067.4-2189s21c1
Sequence:CCGGCAGATAGTGTCAGCTTATTTGCTCGAGCAAATAAGCTGACACTATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009067.4-848s21c1
Sequence:CCGGCAGCTTGCTGAAGCAGTATTTCTCGAGAAATACTGCTTCAGCAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009067.4-1424s21c1
Sequence:CCGGACAGGAGATAGCTAGTCTTTCCTCGAGGAAAGACTAGCTATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009067.4-809s21c1
Sequence:CCGGGTCTCCAAACTTAGAAGAATACTCGAGTATTCTTCTAAGTTTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009067.1-3232s1c1
Sequence:CCGGCCTCCCTAGTTAGTATTTATTCTCGAGAATAAATACTAACTAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009067.1-1455s1c1
Sequence:CCGGGCGGGATAAAGGACTTATCTACTCGAGTAGATAAGTCCTTTATCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009067.1-955s1c1
Sequence:CCGGGTCTCCAAACTTAGAAGAATACTCGAGTATTCTTCTAAGTTTGGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009067.1-371s1c1
Sequence:CCGGCCTCCTGATACAGTGTCAGATCTCGAGATCTGACACTGTATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009067.1-1753s1c1
Sequence:CCGGCCGAGCTGAAATTGCGGAGATCTCGAGATCTCCGCAATTTCAGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006788
VALIDATED
RALBP1 MISSION shRNA Bacterial Glycerol Stock
ralA binding protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006788.3-1581s21c1
Sequence:CCGGGCACAAGAGATAGCCAGTCTTCTCGAGAAGACTGGCTATCTCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006788.3-317s21c1
Sequence:CCGGCCCTACTAAGTTTCCTGGATTCTCGAGAATCCAGGAAACTTAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006788.3-384s21c1
Sequence:CCGGCCTCCTGATGTAGTGTCTGATCTCGAGATCAGACACTACATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006788.3-1038s21c1
Sequence:CCGGCCAGAGAATTTGCTTACCAAACTCGAGTTTGGTAAGCAAATTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006788.3-1038s1c1
Sequence:CCGGCCAGAGAATTTGCTTACCAAACTCGAGTTTGGTAAGCAAATTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006788.3-1581s1c1
Sequence:CCGGGCACAAGAGATAGCCAGTCTTCTCGAGAAGACTGGCTATCTCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006788.3-317s1c1
Sequence:CCGGCCCTACTAAGTTTCCTGGATTCTCGAGAATCCAGGAAACTTAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006788.3-384s1c1
Sequence:CCGGCCTCCTGATGTAGTGTCTGATCTCGAGATCAGACACTACATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006788.3-1005s1c1
Sequence:CCGGGCCAGTTTGCTGAAGCAGTATCTCGAGATACTGCTTCAGCAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006788
VALIDATED
RALBP1 MISSION shRNA shRNA Plasmid DNA
ralA binding protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006788.3-1581s21c1
Sequence:CCGGGCACAAGAGATAGCCAGTCTTCTCGAGAAGACTGGCTATCTCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006788.3-317s21c1
Sequence:CCGGCCCTACTAAGTTTCCTGGATTCTCGAGAATCCAGGAAACTTAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006788.3-384s21c1
Sequence:CCGGCCTCCTGATGTAGTGTCTGATCTCGAGATCAGACACTACATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006788.3-1038s21c1
Sequence:CCGGCCAGAGAATTTGCTTACCAAACTCGAGTTTGGTAAGCAAATTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006788.3-1038s1c1
Sequence:CCGGCCAGAGAATTTGCTTACCAAACTCGAGTTTGGTAAGCAAATTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006788.3-1581s1c1
Sequence:CCGGGCACAAGAGATAGCCAGTCTTCTCGAGAAGACTGGCTATCTCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006788.3-317s1c1
Sequence:CCGGCCCTACTAAGTTTCCTGGATTCTCGAGAATCCAGGAAACTTAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006788.3-384s1c1
Sequence:CCGGCCTCCTGATGTAGTGTCTGATCTCGAGATCAGACACTACATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006788.3-1005s1c1
Sequence:CCGGGCCAGTTTGCTGAAGCAGTATCTCGAGATACTGCTTCAGCAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006788
VALIDATED
RALBP1 MISSION shRNA Lentiviral Transduction Particles
ralA binding protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006788.3-1581s21c1
Sequence:CCGGGCACAAGAGATAGCCAGTCTTCTCGAGAAGACTGGCTATCTCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_006788.3-317s21c1
Sequence:CCGGCCCTACTAAGTTTCCTGGATTCTCGAGAATCCAGGAAACTTAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006788.3-384s21c1
Sequence:CCGGCCTCCTGATGTAGTGTCTGATCTCGAGATCAGACACTACATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006788.3-1038s21c1
Sequence:CCGGCCAGAGAATTTGCTTACCAAACTCGAGTTTGGTAAGCAAATTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006788.3-1038s1c1
Sequence:CCGGCCAGAGAATTTGCTTACCAAACTCGAGTTTGGTAAGCAAATTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006788.3-1581s1c1
Sequence:CCGGGCACAAGAGATAGCCAGTCTTCTCGAGAAGACTGGCTATCTCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006788.3-317s1c1
Sequence:CCGGCCCTACTAAGTTTCCTGGATTCTCGAGAATCCAGGAAACTTAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006788.3-384s1c1
Sequence:CCGGCCTCCTGATGTAGTGTCTGATCTCGAGATCAGACACTACATCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006788.3-1005s1c1
Sequence:CCGGGCCAGTTTGCTGAAGCAGTATCTCGAGATACTGCTTCAGCAAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks