EMAIL THIS PAGE TO A FRIEND

RAP1BL

Species: Human RAP1BL(643752)
Gene ID:
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001089704 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001089704 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001089704 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001089704 Rosetta Predictions human pricing
XM_928885 siRNAs that have been validated in the lab human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001089704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318065 predicted 756
2 SASI_Hs02_00318066 predicted 259
3 SASI_Hs02_00318067 predicted 574
4 SASI_Hs02_00318068 predicted 441
5 SASI_Hs02_00318069 predicted 700
6 SASI_Hs02_00318070 predicted 432
7 SASI_Hs02_00318071 predicted 708
8 SASI_Hs02_00318072 predicted 364
9 SASI_Hs02_00318073 predicted 218
10 SASI_Hs02_00318074 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928885 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278474 validated 760
2 SASI_Hs01_00278475 predicted 220
3 SASI_Hs01_00278476 predicted 587
4 SASI_Hs01_00278477 predicted 502
5 SASI_Hs01_00278478 predicted 707
6 SASI_Hs01_00278479 predicted 276
7 SASI_Hs01_00278480 predicted 400
8 SASI_Hs01_00278481 predicted 789
9 SASI_Hs01_00278482 predicted 717
10 SASI_Hs01_00278483 predicted 218
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001089704
RAP1BL MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089704.3-638s21c1
Sequence:CCGGTATGACCTAGTGCGGCAAATTCTCGAGAATTTGCCGCACTAGGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089704.3-354s21c1
Sequence:CCGGTTACAGCAATGAGGGATTTATCTCGAGATAAATCCCTCATTGCTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089704.3-388s21c1
Sequence:CCGGACAAGGGTTTGCATTAGTTTACTCGAGTAAACTAATGCAAACCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001089704.3-1119s21c1
Sequence:CCGGAGTCCAAAGAGCTCCTATATACTCGAGTATATAGGAGCTCTTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089704.3-423s21c1
Sequence:CCGGAGTCCACATTTAACGATTTACCTCGAGGTAAATCGTTAAATGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001089704
RAP1BL MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089704.3-638s21c1
Sequence:CCGGTATGACCTAGTGCGGCAAATTCTCGAGAATTTGCCGCACTAGGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089704.3-354s21c1
Sequence:CCGGTTACAGCAATGAGGGATTTATCTCGAGATAAATCCCTCATTGCTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089704.3-388s21c1
Sequence:CCGGACAAGGGTTTGCATTAGTTTACTCGAGTAAACTAATGCAAACCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001089704.3-1119s21c1
Sequence:CCGGAGTCCAAAGAGCTCCTATATACTCGAGTATATAGGAGCTCTTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089704.3-423s21c1
Sequence:CCGGAGTCCACATTTAACGATTTACCTCGAGGTAAATCGTTAAATGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001089704
RAP1BL MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089704.3-638s21c1
Sequence:CCGGTATGACCTAGTGCGGCAAATTCTCGAGAATTTGCCGCACTAGGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089704.3-354s21c1
Sequence:CCGGTTACAGCAATGAGGGATTTATCTCGAGATAAATCCCTCATTGCTGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089704.3-388s21c1
Sequence:CCGGACAAGGGTTTGCATTAGTTTACTCGAGTAAACTAATGCAAACCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001089704.3-1119s21c1
Sequence:CCGGAGTCCAAAGAGCTCCTATATACTCGAGTATATAGGAGCTCTTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001089704.3-423s21c1
Sequence:CCGGAGTCCACATTTAACGATTTACCTCGAGGTAAATCGTTAAATGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks