EMAIL THIS PAGE TO A FRIEND

RAP1GAP2

RAP1 GTPase activating protein 2

Synonyms: GARNL4 RAP1GA3
UniProtKB ID: Q684P5, B2RTY5, Q684P4, Q6AI00, Q6ZVF0, Q9UPW2
Gene ID:
Human(23108) Summary: This gene encodes a GTPase-activating protein that activates the small guanine-nucleotide-binding protein Rap1 in platelets. The protein interacts with synaptotagmin-like protein 1 and Rab27 and regulates secretion of dense granules from platelets at sites of endothelial damage. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Mouse(380711) RAP1 GTPase activating protein 2
Rat(303298) RAP1 GTPase activating protein 2
cow(786649) RAP1 GTPase activating protein 2
sheep(101105513) RAP1 GTPase activating protein 2
domestic guinea pig(100714299) RAP1 GTPase activating protein 2
naked mole-rat(101712428) RAP1 GTPase activating protein 2
chicken(427841) RAP1 GTPase activating protein 2
domestic cat(101097683) RAP1 GTPase activating protein 2
dog(491204) RAP1 GTPase activating protein 2
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001015046 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001015046 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001015046 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015085 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015085 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015085 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055191 MISSION® esiRNA esiRNA human GARNL4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100398 Rosetta Predictions human pricing
NM_015085 Rosetta Predictions human pricing
NM_001107019 Rosetta Predictions rat pricing
NM_001015046 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100398 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321924 predicted 814
2 SASI_Hs02_00321925 predicted 746
3 SASI_Hs02_00321926 predicted 705
4 SASI_Hs02_00321927 predicted 2051
5 SASI_Hs02_00321928 predicted 773
6 SASI_Hs02_00321929 predicted 1159
7 SASI_Hs02_00321930 predicted 2045
8 SASI_Hs02_00321931 predicted 2181
9 SASI_Hs02_00321932 predicted 806
10 SASI_Hs02_00321933 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015085 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346962 predicted 865
2 SASI_Hs01_00048641 predicted 791
3 SASI_Hs01_00048643 predicted 751
4 SASI_Hs01_00048644 predicted 2094
5 SASI_Hs01_00048645 predicted 823
6 SASI_Hs01_00048647 predicted 1198
7 SASI_Hs01_00048648 predicted 2089
8 SASI_Hs02_00346963 predicted 2224
9 SASI_Hs01_00048649 predicted 852
10 SASI_Hs02_00346964 predicted 862
11 SASI_Hs01_00048640 predicted 529
12 SASI_Hs01_00048642 predicted 246
13 SASI_Hs01_00048646 predicted 828
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107019 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224686 predicted 581
2 SASI_Rn02_00224687 predicted 1495
3 SASI_Rn02_00224688 predicted 536
4 SASI_Rn02_00224689 predicted 1365
5 SASI_Rn02_00224690 predicted 591
6 SASI_Rn02_00224691 predicted 226
7 SASI_Rn02_00224692 predicted 1273
8 SASI_Rn02_00224693 predicted 1265
9 SASI_Rn02_00224694 predicted 882
10 SASI_Rn02_00224695 predicted 784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015046 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151851 predicted 2343
2 SASI_Mm01_00151852 predicted 348
3 SASI_Mm01_00151853 predicted 2405
4 SASI_Mm01_00151854 predicted 2158
5 SASI_Mm01_00151855 predicted 384
6 SASI_Mm01_00151856 predicted 1988
7 SASI_Mm01_00151857 predicted 1271
8 SASI_Mm01_00151858 predicted 895
9 SASI_Mm01_00151859 predicted 1339
10 SASI_Mm01_00151860 predicted 894
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001015046
VALIDATED
RAP1GAP2 MISSION shRNA Bacterial Glycerol Stock
RAP1 GTPase activating protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106130    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001015046.1-5518s1c1
Sequence:CCGGGCCAACTCAAACATCACCTTTCTCGAGAAAGGTGATGTTTGAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001015046.1-1237s1c1
Sequence:CCGGCCCAGATATGATCGCATCAAACTCGAGTTTGATGCGATCATATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001015046.1-944s1c1
Sequence:CCGGGAGGAGCTATTTGGGAATAATCTCGAGATTATTCCCAAATAGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001015046.1-2263s1c1
Sequence:CCGGCCTGAAATTCCGCTTTGATAACTCGAGTTATCAAAGCGGAATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001015046.1-2273s1c1
Sequence:CCGGCGCTTTGATAAACTCAGCCATCTCGAGATGGCTGAGTTTATCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001015046
VALIDATED
RAP1GAP2 MISSION shRNA shRNA Plasmid DNA
RAP1 GTPase activating protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106130    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001015046.1-5518s1c1
Sequence:CCGGGCCAACTCAAACATCACCTTTCTCGAGAAAGGTGATGTTTGAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001015046.1-1237s1c1
Sequence:CCGGCCCAGATATGATCGCATCAAACTCGAGTTTGATGCGATCATATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001015046.1-944s1c1
Sequence:CCGGGAGGAGCTATTTGGGAATAATCTCGAGATTATTCCCAAATAGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001015046.1-2263s1c1
Sequence:CCGGCCTGAAATTCCGCTTTGATAACTCGAGTTATCAAAGCGGAATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001015046.1-2273s1c1
Sequence:CCGGCGCTTTGATAAACTCAGCCATCTCGAGATGGCTGAGTTTATCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001015046
VALIDATED
RAP1GAP2 MISSION shRNA Lentiviral Transduction Particles
RAP1 GTPase activating protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106130    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001015046.1-5518s1c1
Sequence:CCGGGCCAACTCAAACATCACCTTTCTCGAGAAAGGTGATGTTTGAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001015046.1-1237s1c1
Sequence:CCGGCCCAGATATGATCGCATCAAACTCGAGTTTGATGCGATCATATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001015046.1-944s1c1
Sequence:CCGGGAGGAGCTATTTGGGAATAATCTCGAGATTATTCCCAAATAGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001015046.1-2263s1c1
Sequence:CCGGCCTGAAATTCCGCTTTGATAACTCGAGTTATCAAAGCGGAATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001015046.1-2273s1c1
Sequence:CCGGCGCTTTGATAAACTCAGCCATCTCGAGATGGCTGAGTTTATCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015085
RAP1GAP2 MISSION shRNA Bacterial Glycerol Stock
RAP1 GTPase activating protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015085.3-3817s1c1
Sequence:CCGGCCACGACCAATGACAAGGATTCTCGAGAATCCTTGTCATTGGTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015085.3-1953s1c1
Sequence:CCGGGAAGCCCTTCATGAAGTTGAACTCGAGTTCAACTTCATGAAGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161392    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015085.3-5778s1c1
Sequence:CCGGGCCAACTCAAACACTACCTTTCTCGAGAAAGGTAGTGTTTGAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161447    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015085.3-2562s1c1
Sequence:CCGGCGGGTCCTTTATCATCCTATTCTCGAGAATAGGATGATAAAGGACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015085.3-333s1c1
Sequence:CCGGCAAGGACGACTATATCCCATACTCGAGTATGGGATATAGTCGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015085.3-781s1c1
Sequence:CCGGGCAGTGGGACTGAGATTCAATCTCGAGATTGAATCTCAGTCCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015085.3-621s1c1
Sequence:CCGGGAACTTGATCCTGTCCGTCAACTCGAGTTGACGGACAGGATCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015085.3-255s1c1
Sequence:CCGGGTCGTCGGAGTTCTTTGAGATCTCGAGATCTCAAAGAACTCCGACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015085.3-750s1c1
Sequence:CCGGCCCTCAGATTGCAAAGGCTTTCTCGAGAAAGCCTTTGCAATCTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015085
RAP1GAP2 MISSION shRNA shRNA Plasmid DNA
RAP1 GTPase activating protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015085.3-3817s1c1
Sequence:CCGGCCACGACCAATGACAAGGATTCTCGAGAATCCTTGTCATTGGTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015085.3-1953s1c1
Sequence:CCGGGAAGCCCTTCATGAAGTTGAACTCGAGTTCAACTTCATGAAGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161392    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015085.3-5778s1c1
Sequence:CCGGGCCAACTCAAACACTACCTTTCTCGAGAAAGGTAGTGTTTGAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161447    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015085.3-2562s1c1
Sequence:CCGGCGGGTCCTTTATCATCCTATTCTCGAGAATAGGATGATAAAGGACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015085.3-333s1c1
Sequence:CCGGCAAGGACGACTATATCCCATACTCGAGTATGGGATATAGTCGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015085.3-781s1c1
Sequence:CCGGGCAGTGGGACTGAGATTCAATCTCGAGATTGAATCTCAGTCCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015085.3-621s1c1
Sequence:CCGGGAACTTGATCCTGTCCGTCAACTCGAGTTGACGGACAGGATCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015085.3-255s1c1
Sequence:CCGGGTCGTCGGAGTTCTTTGAGATCTCGAGATCTCAAAGAACTCCGACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015085.3-750s1c1
Sequence:CCGGCCCTCAGATTGCAAAGGCTTTCTCGAGAAAGCCTTTGCAATCTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015085
RAP1GAP2 MISSION shRNA Lentiviral Transduction Particles
RAP1 GTPase activating protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166459    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015085.3-3817s1c1
Sequence:CCGGCCACGACCAATGACAAGGATTCTCGAGAATCCTTGTCATTGGTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015085.3-1953s1c1
Sequence:CCGGGAAGCCCTTCATGAAGTTGAACTCGAGTTCAACTTCATGAAGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161392    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015085.3-5778s1c1
Sequence:CCGGGCCAACTCAAACACTACCTTTCTCGAGAAAGGTAGTGTTTGAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161447    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015085.3-2562s1c1
Sequence:CCGGCGGGTCCTTTATCATCCTATTCTCGAGAATAGGATGATAAAGGACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015085.3-333s1c1
Sequence:CCGGCAAGGACGACTATATCCCATACTCGAGTATGGGATATAGTCGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015085.3-781s1c1
Sequence:CCGGGCAGTGGGACTGAGATTCAATCTCGAGATTGAATCTCAGTCCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015085.3-621s1c1
Sequence:CCGGGAACTTGATCCTGTCCGTCAACTCGAGTTGACGGACAGGATCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015085.3-255s1c1
Sequence:CCGGGTCGTCGGAGTTCTTTGAGATCTCGAGATCTCAAAGAACTCCGACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015085.3-750s1c1
Sequence:CCGGCCCTCAGATTGCAAAGGCTTTCTCGAGAAAGCCTTTGCAATCTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks