EMAIL THIS PAGE TO A FRIEND

RAP2A

RAP2A, member of RAS oncogene family

Synonyms: K-REV KREV RAP2 RbBP-30
UniProtKB ID: P10114, B2RCJ1, Q5JSC1, Q5JSC2
Gene ID:
Mouse(76108) RAS related protein 2a
Rat(114560) RAS related protein 2a
chicken(769797) RAP2A, member of RAS oncogene family
dog(476968) RAP2A, member of RAS oncogene family
cow(522707) RAP2A, member of RAS oncogene family
sheep(101111203) RAP2A, member of RAS oncogene family
sheep(100302081) RAP2A, member of RAS oncogene family
naked mole-rat(101714988) RAP2A, member of RAS oncogene family
215 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1104797 Anti-RAP2A (146-156) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2700406 Anti-RAP2A antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2107823 Anti-RAP2A antibody produced in rabbit affinity isolated antibody human, horse, sheep, guinea pig, rabbit
ELISA, western blot pricing
SAB2107824 Anti-RAP2A antibody produced in rabbit affinity isolated antibody sheep, human, horse, rabbit, guinea pig
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021033 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021033 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021033 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029519 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029519 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029519 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU034761 MISSION® esiRNA esiRNA human RAP2A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021033 Rosetta Predictions human pricing
NM_053741 Rosetta Predictions rat pricing
NM_029519 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021033 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148112 predicted 957
2 SASI_Hs01_00148113 predicted 1058
3 SASI_Hs01_00148114 predicted 830
4 SASI_Hs01_00148116 predicted 676
5 SASI_Hs02_00354508 predicted 715
6 SASI_Hs01_00148117 predicted 1045
7 SASI_Hs01_00148118 predicted 876
8 SASI_Hs01_00148119 predicted 579
9 SASI_Hs02_00354509 predicted 784
10 SASI_Hs01_00148120 predicted 1078
11 SASI_Hs01_00148115 predicted 908
12 SASI_Hs01_00148121 predicted 939
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053741 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081064 predicted 64
2 SASI_Rn01_00081065 predicted 81
3 SASI_Rn01_00081066 predicted 73
4 SASI_Rn01_00081068 predicted 418
5 SASI_Rn01_00081069 predicted 450
6 SASI_Rn01_00081070 predicted 80
7 SASI_Rn01_00081071 predicted 306
8 SASI_Rn01_00081072 predicted 150
9 SASI_Rn01_00081067 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029519 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085781 predicted 946
2 SASI_Mm02_00335465 predicted 693
3 SASI_Mm02_00335466 predicted 788
4 SASI_Mm02_00335467 predicted 586
5 SASI_Mm01_00085783 predicted 867
6 SASI_Mm01_00085784 predicted 861
7 SASI_Mm01_00085786 predicted 789
8 SASI_Mm01_00085787 predicted 777
9 SASI_Mm01_00085788 predicted 739
10 SASI_Mm01_00085789 predicted 958
11 SASI_Mm01_00085782 predicted 566
12 SASI_Mm01_00085785 predicted 795
13 SASI_Mm01_00085790 predicted 798
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021033
VALIDATED
RAP2A MISSION shRNA Bacterial Glycerol Stock
RAP2A, member of RAS oncogene family
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021033.6-1013s21c1
Sequence:CCGGCTTTATGCATCTGCAACTTTACTCGAGTAAAGTTGCAGATGCATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021033.6-603s21c1
Sequence:CCGGTGGACCTGGAAAGTGAGAGAGCTCGAGCTCTCTCACTTTCCAGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021033.6-710s21c1
Sequence:CCGGGACGAACTCTTTGCAGAAATTCTCGAGAATTTCTGCAAAGAGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021033.6-325s21c1
Sequence:CCGGCGGCACCTTCATCGAGAAATACTCGAGTATTTCTCGATGAAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021033.6-951s21c1
Sequence:CCGGTGATATCTCTGAGTAACATTTCTCGAGAAATGTTACTCAGAGATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021033.6-746s21c1
Sequence:CCGGTATGCTGCTCAGCCTGACAAACTCGAGTTTGTCAGGCTGAGCAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_021033.3-331s1c1
Sequence:CCGGCGGCACCTTCATCGAGAAATACTCGAGTATTTCTCGATGAAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_021033.3-786s1c1
Sequence:CCGGGTTCTGCATGTAACATACAATCTCGAGATTGTATGTTACATGCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021033.3-678s1c1
Sequence:CCGGCCTTTATGGAAACTTCCGCTACTCGAGTAGCGGAAGTTTCCATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_021033.3-716s1c1
Sequence:CCGGGACGAACTCTTTGCAGAAATTCTCGAGAATTTCTGCAAAGAGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021033.3-571s1c1
Sequence:CCGGGTATGAGAAAGTGCCAGTCATCTCGAGATGACTGGCACTTTCTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021033
VALIDATED
RAP2A MISSION shRNA shRNA Plasmid DNA
RAP2A, member of RAS oncogene family
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021033.6-1013s21c1
Sequence:CCGGCTTTATGCATCTGCAACTTTACTCGAGTAAAGTTGCAGATGCATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021033.6-603s21c1
Sequence:CCGGTGGACCTGGAAAGTGAGAGAGCTCGAGCTCTCTCACTTTCCAGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021033.6-710s21c1
Sequence:CCGGGACGAACTCTTTGCAGAAATTCTCGAGAATTTCTGCAAAGAGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021033.6-325s21c1
Sequence:CCGGCGGCACCTTCATCGAGAAATACTCGAGTATTTCTCGATGAAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021033.6-951s21c1
Sequence:CCGGTGATATCTCTGAGTAACATTTCTCGAGAAATGTTACTCAGAGATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021033.6-746s21c1
Sequence:CCGGTATGCTGCTCAGCCTGACAAACTCGAGTTTGTCAGGCTGAGCAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_021033.3-331s1c1
Sequence:CCGGCGGCACCTTCATCGAGAAATACTCGAGTATTTCTCGATGAAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_021033.3-786s1c1
Sequence:CCGGGTTCTGCATGTAACATACAATCTCGAGATTGTATGTTACATGCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021033.3-678s1c1
Sequence:CCGGCCTTTATGGAAACTTCCGCTACTCGAGTAGCGGAAGTTTCCATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_021033.3-716s1c1
Sequence:CCGGGACGAACTCTTTGCAGAAATTCTCGAGAATTTCTGCAAAGAGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021033.3-571s1c1
Sequence:CCGGGTATGAGAAAGTGCCAGTCATCTCGAGATGACTGGCACTTTCTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021033
VALIDATED
RAP2A MISSION shRNA Lentiviral Transduction Particles
RAP2A, member of RAS oncogene family
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021033.6-1013s21c1
Sequence:CCGGCTTTATGCATCTGCAACTTTACTCGAGTAAAGTTGCAGATGCATAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021033.6-603s21c1
Sequence:CCGGTGGACCTGGAAAGTGAGAGAGCTCGAGCTCTCTCACTTTCCAGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021033.6-710s21c1
Sequence:CCGGGACGAACTCTTTGCAGAAATTCTCGAGAATTTCTGCAAAGAGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021033.6-325s21c1
Sequence:CCGGCGGCACCTTCATCGAGAAATACTCGAGTATTTCTCGATGAAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021033.6-951s21c1
Sequence:CCGGTGATATCTCTGAGTAACATTTCTCGAGAAATGTTACTCAGAGATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021033.6-746s21c1
Sequence:CCGGTATGCTGCTCAGCCTGACAAACTCGAGTTTGTCAGGCTGAGCAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_021033.3-331s1c1
Sequence:CCGGCGGCACCTTCATCGAGAAATACTCGAGTATTTCTCGATGAAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_021033.3-786s1c1
Sequence:CCGGGTTCTGCATGTAACATACAATCTCGAGATTGTATGTTACATGCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021033.3-678s1c1
Sequence:CCGGCCTTTATGGAAACTTCCGCTACTCGAGTAGCGGAAGTTTCCATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_021033.3-716s1c1
Sequence:CCGGGACGAACTCTTTGCAGAAATTCTCGAGAATTTCTGCAAAGAGTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021033.3-571s1c1
Sequence:CCGGGTATGAGAAAGTGCCAGTCATCTCGAGATGACTGGCACTTTCTCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029519
VALIDATED
RAP2A MISSION shRNA Bacterial Glycerol Stock
RAP2A, member of RAS oncogene family
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029519.3-687s21c1
Sequence:CCGGCCCTTTATGGAGACTTCTGCTCTCGAGAGCAGAAGTCTCCATAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029519.3-788s21c1
Sequence:CCGGCCCATGCTGTTCTGCCTGTAACTCGAGTTACAGGCAGAACAGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029519.3-745s21c1
Sequence:CCGGTTGTGCGGCAGATGAACTATGCTCGAGCATAGTTCATCTGCCGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029519.3-339s21c1
Sequence:CCGGACCGGCACCTTCATTGAGAAACTCGAGTTTCTCAATGAAGGTGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029519.3-1104s21c1
Sequence:CCGGGCCACTGTTGTGTAAACTAAACTCGAGTTTAGTTTACACAACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102795    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029519.2-1104s1c1
Sequence:CCGGGCCACTGTTGTGTAAACTAAACTCGAGTTTAGTTTACACAACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029519.2-503s1c1
Sequence:CCGGCCTGGTCTACAGCTTGGTCAACTCGAGTTGACCAAGCTGTAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029519.2-687s1c1
Sequence:CCGGCCCTTTATGGAGACTTCTGCTCTCGAGAGCAGAAGTCTCCATAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029519.2-339s1c1
Sequence:CCGGACCGGCACCTTCATTGAGAAACTCGAGTTTCTCAATGAAGGTGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029519.2-788s1c1
Sequence:CCGGCCCATGCTGTTCTGCCTGTAACTCGAGTTACAGGCAGAACAGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029519
VALIDATED
RAP2A MISSION shRNA shRNA Plasmid DNA
RAP2A, member of RAS oncogene family
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029519.3-687s21c1
Sequence:CCGGCCCTTTATGGAGACTTCTGCTCTCGAGAGCAGAAGTCTCCATAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029519.3-788s21c1
Sequence:CCGGCCCATGCTGTTCTGCCTGTAACTCGAGTTACAGGCAGAACAGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029519.3-745s21c1
Sequence:CCGGTTGTGCGGCAGATGAACTATGCTCGAGCATAGTTCATCTGCCGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029519.3-339s21c1
Sequence:CCGGACCGGCACCTTCATTGAGAAACTCGAGTTTCTCAATGAAGGTGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029519.3-1104s21c1
Sequence:CCGGGCCACTGTTGTGTAAACTAAACTCGAGTTTAGTTTACACAACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102795    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029519.2-1104s1c1
Sequence:CCGGGCCACTGTTGTGTAAACTAAACTCGAGTTTAGTTTACACAACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029519.2-503s1c1
Sequence:CCGGCCTGGTCTACAGCTTGGTCAACTCGAGTTGACCAAGCTGTAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029519.2-687s1c1
Sequence:CCGGCCCTTTATGGAGACTTCTGCTCTCGAGAGCAGAAGTCTCCATAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029519.2-339s1c1
Sequence:CCGGACCGGCACCTTCATTGAGAAACTCGAGTTTCTCAATGAAGGTGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029519.2-788s1c1
Sequence:CCGGCCCATGCTGTTCTGCCTGTAACTCGAGTTACAGGCAGAACAGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029519
VALIDATED
RAP2A MISSION shRNA Lentiviral Transduction Particles
RAP2A, member of RAS oncogene family
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029519.3-687s21c1
Sequence:CCGGCCCTTTATGGAGACTTCTGCTCTCGAGAGCAGAAGTCTCCATAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029519.3-788s21c1
Sequence:CCGGCCCATGCTGTTCTGCCTGTAACTCGAGTTACAGGCAGAACAGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029519.3-745s21c1
Sequence:CCGGTTGTGCGGCAGATGAACTATGCTCGAGCATAGTTCATCTGCCGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029519.3-339s21c1
Sequence:CCGGACCGGCACCTTCATTGAGAAACTCGAGTTTCTCAATGAAGGTGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326458    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029519.3-1104s21c1
Sequence:CCGGGCCACTGTTGTGTAAACTAAACTCGAGTTTAGTTTACACAACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102795    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029519.2-1104s1c1
Sequence:CCGGGCCACTGTTGTGTAAACTAAACTCGAGTTTAGTTTACACAACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029519.2-503s1c1
Sequence:CCGGCCTGGTCTACAGCTTGGTCAACTCGAGTTGACCAAGCTGTAGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029519.2-687s1c1
Sequence:CCGGCCCTTTATGGAGACTTCTGCTCTCGAGAGCAGAAGTCTCCATAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029519.2-339s1c1
Sequence:CCGGACCGGCACCTTCATTGAGAAACTCGAGTTTCTCAATGAAGGTGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029519.2-788s1c1
Sequence:CCGGCCCATGCTGTTCTGCCTGTAACTCGAGTTACAGGCAGAACAGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks