EMAIL THIS PAGE TO A FRIEND

RAP2C

RAP2C, member of RAS oncogene family

UniProtKB ID: Q9Y3L5, B3KWD6, Q5H9H9, Q9BTS0
Gene ID:
Human(57826) Summary: The protein encoded by this gene is a member of the Ras-related protein subfamily of the Ras GTPase superfamily. Members of this family are small GTPases that act as molecular switches to regulate cellular proliferation, differentiation, and apoptosis. This protein has been reported to activate in vitro transcriptional activity of the serum response element. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012]
Mouse(72065) RAP2C, member of RAS oncogene family
Rat(302495) RAP2C, member of RAS oncogene family
cow(515181) RAP2C, member of RAS oncogene family
sheep(101111258) RAP2C, member of RAS oncogene family
domestic guinea pig(100724064) RAP2C, member of RAS oncogene family
naked mole-rat(101729407) RAP2C, member of RAS oncogene family
Zebrafish(474323) RAP2C, member of RAS oncogene family
dog(481054) RAP2C, member of RAS oncogene family
domestic cat(101085611) RAP2C, member of RAS oncogene family
chicken(422232) RAP2C, member of RAS oncogene family
166 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2700397 Anti-RAP2C antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB4502538 Anti-RAP2C antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021183 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021183 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021183 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172413 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172413 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172413 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021183 Rosetta Predictions human pricing
NM_001106950 Rosetta Predictions rat pricing
XR_006183 Rosetta Predictions rat pricing
NM_172413 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021183 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115535 predicted 1314
2 SASI_Hs01_00115536 predicted 1064
3 SASI_Hs02_00354752 predicted 1226
4 SASI_Hs01_00115537 predicted 1105
5 SASI_Hs01_00115538 predicted 1079
6 SASI_Hs01_00115539 predicted 1021
7 SASI_Hs01_00115540 predicted 1058
8 SASI_Hs01_00115541 predicted 1018
9 SASI_Hs01_00115542 predicted 1031
10 SASI_Hs01_00115544 predicted 1374
11 SASI_Hs01_00115543 predicted 1018
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106950 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224006 predicted 356
2 SASI_Rn02_00224007 predicted 861
3 SASI_Rn02_00224008 predicted 315
4 SASI_Rn02_00224009 predicted 494
5 SASI_Rn02_00224010 predicted 444
6 SASI_Rn02_00224011 predicted 815
7 SASI_Rn02_00224012 predicted 457
8 SASI_Rn02_00224013 predicted 357
9 SASI_Rn02_00224014 predicted 800
10 SASI_Rn02_00224015 predicted 929
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_006183 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00185276 predicted 1297
2 SASI_Rn01_00185277 predicted 1420
3 SASI_Rn01_00185278 predicted 487
4 SASI_Rn01_00185279 predicted 1431
5 SASI_Rn01_00185280 predicted 987
6 SASI_Rn01_00185281 predicted 575
7 SASI_Rn01_00185282 predicted 1436
8 SASI_Rn01_00185283 predicted 1072
9 SASI_Rn01_00185284 predicted 1824
10 SASI_Rn01_00185285 predicted 943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172413 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343883 predicted 591
2 SASI_Mm01_00099938 predicted 359
3 SASI_Mm01_00099939 predicted 644
4 SASI_Mm01_00099940 predicted 407
5 SASI_Mm01_00099941 predicted 494
6 SASI_Mm01_00099942 predicted 439
7 SASI_Mm01_00099943 predicted 816
8 SASI_Mm01_00099944 predicted 793
9 SASI_Mm01_00099945 predicted 300
10 SASI_Mm01_00099947 predicted 418
11 SASI_Mm01_00099946 predicted 643
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021183
RAP2C MISSION shRNA Bacterial Glycerol Stock
RAP2C, member of RAS oncogene family
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021183.3-1177s21c1
Sequence:CCAGCAGAGCTCTGGCTCAAGAATGCTCGAGCATTCTTGAGCCAGAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021183.3-1543s21c1
Sequence:CCGGCACGTTTACCATACGTTTAAACTCGAGTTTAAACGTATGGTAAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021183.3-1616s21c1
Sequence:CCGGGCTAATATACAAGGGTTAATTCTCGAGAATTAACCCTTGTATATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021183.3-1021s1c1
Sequence:CCGGCCTGGTTTATAGCCTGGTTAACTCGAGTTAACCAGGCTATAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021183.3-1032s1c1
Sequence:CCGGGCCTGGTTAATCAACAGTCTTCTCGAGAAGACTGTTGATTAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021183.3-1111s1c1
Sequence:CCGGCCCACTAATCCTAGTAGGAAACTCGAGTTTCCTACTAGGATTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021183.3-1296s1c1
Sequence:CCGGAGAAGCAAGATCAGTGTTGTACTCGAGTACAACACTGATCTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021183.3-889s1c1
Sequence:CCGGCATTGAAGATTTCTACCGCAACTCGAGTTGCGGTAGAAATCTTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021183
RAP2C MISSION shRNA shRNA Plasmid DNA
RAP2C, member of RAS oncogene family
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021183.3-1177s21c1
Sequence:CCAGCAGAGCTCTGGCTCAAGAATGCTCGAGCATTCTTGAGCCAGAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021183.3-1543s21c1
Sequence:CCGGCACGTTTACCATACGTTTAAACTCGAGTTTAAACGTATGGTAAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021183.3-1616s21c1
Sequence:CCGGGCTAATATACAAGGGTTAATTCTCGAGAATTAACCCTTGTATATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021183.3-1021s1c1
Sequence:CCGGCCTGGTTTATAGCCTGGTTAACTCGAGTTAACCAGGCTATAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021183.3-1032s1c1
Sequence:CCGGGCCTGGTTAATCAACAGTCTTCTCGAGAAGACTGTTGATTAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021183.3-1111s1c1
Sequence:CCGGCCCACTAATCCTAGTAGGAAACTCGAGTTTCCTACTAGGATTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021183.3-1296s1c1
Sequence:CCGGAGAAGCAAGATCAGTGTTGTACTCGAGTACAACACTGATCTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021183.3-889s1c1
Sequence:CCGGCATTGAAGATTTCTACCGCAACTCGAGTTGCGGTAGAAATCTTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021183
RAP2C MISSION shRNA Lentiviral Transduction Particles
RAP2C, member of RAS oncogene family
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021183.3-1177s21c1
Sequence:CCAGCAGAGCTCTGGCTCAAGAATGCTCGAGCATTCTTGAGCCAGAGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021183.3-1543s21c1
Sequence:CCGGCACGTTTACCATACGTTTAAACTCGAGTTTAAACGTATGGTAAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021183.3-1616s21c1
Sequence:CCGGGCTAATATACAAGGGTTAATTCTCGAGAATTAACCCTTGTATATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021183.3-1021s1c1
Sequence:CCGGCCTGGTTTATAGCCTGGTTAACTCGAGTTAACCAGGCTATAAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021183.3-1032s1c1
Sequence:CCGGGCCTGGTTAATCAACAGTCTTCTCGAGAAGACTGTTGATTAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021183.3-1111s1c1
Sequence:CCGGCCCACTAATCCTAGTAGGAAACTCGAGTTTCCTACTAGGATTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021183.3-1296s1c1
Sequence:CCGGAGAAGCAAGATCAGTGTTGTACTCGAGTACAACACTGATCTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021183.3-889s1c1
Sequence:CCGGCATTGAAGATTTCTACCGCAACTCGAGTTGCGGTAGAAATCTTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172413
VALIDATED
RAP2C MISSION shRNA Bacterial Glycerol Stock
RAP2C, member of RAS oncogene family
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172413.2-401s21c1
Sequence:CCGGAGCCAATGAGAGATCAGATTGCTCGAGCAATCTGATCTCTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172413.2-481s21c1
Sequence:CCGGGAACCAGAGAGAGAGGTTATGCTCGAGCATAACCTCTCTCTCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172413.2-653s21c1
Sequence:CCGGCAACTTGTGTTGTCCAGTAAACTCGAGTTTACTGGACAACACAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172413.2-425s21c1
Sequence:CCGGGAGTGAAGAGATACGAGAAAGCTCGAGCTTTCTCGTATCTCTTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172413.2-599s21c1
Sequence:CCGGTCGTCAGGCAAATGAACTATTCTCGAGAATAGTTCATTTGCCTGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172413.2-2562s1c1
Sequence:CCGGCCTGTGAAATTCTAAAGGAATCTCGAGATTCCTTTAGAATTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172413.2-346s1c1
Sequence:CCGGCAAGGTTTCATCCTGGTGTATCTCGAGATACACCAGGATGAAACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172413.2-451s1c1
Sequence:CCGGCTCATCCTAGTGGGAAACAAACTCGAGTTTGTTTCCCACTAGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172413.2-368s1c1
Sequence:CCGGGTTTGGTTAATCAACAGTCTTCTCGAGAAGACTGTTGATTAACCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172413.2-195s1c1
Sequence:CCGGCGGGACTTTCATTGAGAAATACTCGAGTATTTCTCAATGAAAGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172413
VALIDATED
RAP2C MISSION shRNA shRNA Plasmid DNA
RAP2C, member of RAS oncogene family
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172413.2-401s21c1
Sequence:CCGGAGCCAATGAGAGATCAGATTGCTCGAGCAATCTGATCTCTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172413.2-481s21c1
Sequence:CCGGGAACCAGAGAGAGAGGTTATGCTCGAGCATAACCTCTCTCTCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172413.2-653s21c1
Sequence:CCGGCAACTTGTGTTGTCCAGTAAACTCGAGTTTACTGGACAACACAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172413.2-425s21c1
Sequence:CCGGGAGTGAAGAGATACGAGAAAGCTCGAGCTTTCTCGTATCTCTTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172413.2-599s21c1
Sequence:CCGGTCGTCAGGCAAATGAACTATTCTCGAGAATAGTTCATTTGCCTGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172413.2-2562s1c1
Sequence:CCGGCCTGTGAAATTCTAAAGGAATCTCGAGATTCCTTTAGAATTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172413.2-346s1c1
Sequence:CCGGCAAGGTTTCATCCTGGTGTATCTCGAGATACACCAGGATGAAACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172413.2-451s1c1
Sequence:CCGGCTCATCCTAGTGGGAAACAAACTCGAGTTTGTTTCCCACTAGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172413.2-368s1c1
Sequence:CCGGGTTTGGTTAATCAACAGTCTTCTCGAGAAGACTGTTGATTAACCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172413.2-195s1c1
Sequence:CCGGCGGGACTTTCATTGAGAAATACTCGAGTATTTCTCAATGAAAGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172413
VALIDATED
RAP2C MISSION shRNA Lentiviral Transduction Particles
RAP2C, member of RAS oncogene family
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172413.2-401s21c1
Sequence:CCGGAGCCAATGAGAGATCAGATTGCTCGAGCAATCTGATCTCTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172413.2-481s21c1
Sequence:CCGGGAACCAGAGAGAGAGGTTATGCTCGAGCATAACCTCTCTCTCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172413.2-653s21c1
Sequence:CCGGCAACTTGTGTTGTCCAGTAAACTCGAGTTTACTGGACAACACAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172413.2-425s21c1
Sequence:CCGGGAGTGAAGAGATACGAGAAAGCTCGAGCTTTCTCGTATCTCTTCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172413.2-599s21c1
Sequence:CCGGTCGTCAGGCAAATGAACTATTCTCGAGAATAGTTCATTTGCCTGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172413.2-2562s1c1
Sequence:CCGGCCTGTGAAATTCTAAAGGAATCTCGAGATTCCTTTAGAATTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172413.2-346s1c1
Sequence:CCGGCAAGGTTTCATCCTGGTGTATCTCGAGATACACCAGGATGAAACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172413.2-451s1c1
Sequence:CCGGCTCATCCTAGTGGGAAACAAACTCGAGTTTGTTTCCCACTAGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172413.2-368s1c1
Sequence:CCGGGTTTGGTTAATCAACAGTCTTCTCGAGAAGACTGTTGATTAACCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172413.2-195s1c1
Sequence:CCGGCGGGACTTTCATTGAGAAATACTCGAGTATTTCTCAATGAAAGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks